Labshake search
Citations for Lonza :
4901 - 4950 of 5517 citations for Recombinant Human Programmed Cell Death 1 Ligand 2 His tagged since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2023Quote: ... different tumor cell lines were stained with carboxyfluorescein succinimidyl ester (CFSE) following the manufacture’s protocols and cultured in X-vivo (Lonza) supplemented with 5% FBS (Gbico ...
-
bioRxiv - Bioengineering 2023Quote: ... each device was seeded directly on the PREDICT96-ALI membrane in the apical chamber with 10,000 cells in Small Airway Epithelial Growth Medium (Lonza) containing 100 U/mL penicillin–streptomycin (Thermo Fisher) ...
-
bioRxiv - Biochemistry 2023Quote: ... DNA (10 μg) was transfected into SmOx P9 cells using a 4D nucleofector system (Lonza Group AG, Basel, Switzerland) with program FI-115 ...
-
bioRxiv - Genomics 2023Quote: 200,000 PUER cells were transfected with 500ng each of Cas9 and donor vector in SF buffer (Lonza, V4SC-2096) using program CM134 of the 4D-Nucleofector (Lonza) ...
-
bioRxiv - Cancer Biology 2023Quote: ... hTERT ipn02.3 2λ cells were transfected by electroporation using the Amaxa Basic Nucleofector Kit for Primary Mammalian Fibroblasts (Lonza) and the program U-023 ...
-
bioRxiv - Molecular Biology 2023Quote: ... 4 x 105 cells were transfected with the pU6-Sp-pegRNA-HEK3-insCTT plasmid (1,000 ng) using the SF Cell Line 96-well Nucleofector Kit (Lonza). Program code was FF-120.
-
bioRxiv - Cancer Biology 2023Quote: ... cells (used for TT-TL seq and ChIP-seq spike-ins) were cultured in Schneider’s modified Drosophila medium (Lonza) supplemented with 10% FBS at 27°C without CO2 ...
-
bioRxiv - Microbiology 2023Quote: ... All cell lines used in this study were regularly screened for Mycoplasma contamination with the MycoAlert Detection Kit (Lonza).
-
bioRxiv - Cell Biology 2023Quote: ... Cells were pelleted at 1000 rpm for 5 min and resuspended in 100 μL nucleofector solution (Lonza, #VPB-1002) before adding 2.5 μg of plasmid ...
-
bioRxiv - Bioengineering 2023Quote: ... The cells were first thawed and seeded on a T150 flask containing bronchial epithelial growth medium (Lonza CC-3170) for 2D cell culture growth ...
-
bioRxiv - Developmental Biology 2023Quote: ... were cultured at 37°C and 5% CO2 in EGMTM Endothelial Cell Growth Medium with BulletKitTM (Lonza CC-3124) and 1x antibiotic-antimycotic (Gibco ...
-
bioRxiv - Cancer Biology 2023Quote: ... Cell lines were routinely verified via STR genotyping and tested for mycoplasma contamination using the Lonza MycoAlert assay (Lonza). Below is a list of cell line details:
-
bioRxiv - Neuroscience 2023Quote: ... MECP2 knock out HAP1 cells from Horizon Discovery (Cat: HZGHC001102c010, RRID: CVCL_SX72) were cultured in IMDM ((Lonza, 12-722F) supplemented with 10% FBS (VWR 97068-085 ...
-
bioRxiv - Cancer Biology 2024Quote: ... and resuspended in 20 µL of SF Cell Line Nucleofector™ Solution with the supplement added (Lonza V4XC-2032). The cells and the RNP complex were carefully mixed and transferred to a well of the 16-well Nucleocuvette™ ...
-
bioRxiv - Genomics 2023Quote: ... Cells were grown at 37°C and 5% CO2 and passed with Hepes buffered saline solution (Lonza, CC-5024) and 0.25% Trypsin-EDTA (Gibco ...
-
bioRxiv - Neuroscience 2023Quote: ... All CRISPR reagents were electroporated into iPSCs using the P3 Primary Cell 4D Nucleofector™ X Kit S (Lonza), as previously described.(25 ...
-
bioRxiv - Biochemistry 2023Quote: Plasma cholesterol was depleted by treating HEK293 cells with 5 mM MβCD for 30 min in Pro293A-CDM (Lonza); this short period of MβCD treatment was deemed sufficient to removed 50% of endogenous cholesterol from cells (34) ...
-
bioRxiv - Neuroscience 2023Quote: ... We regularly monitored all cell cultures for mycoplasma contamination using the MycoAlert™ Mycoplasma Detection Kit (Lonza, #LT07-218).
-
bioRxiv - Molecular Biology 2024Quote: ... once the cell confluency reached 90% the culture medium was changed to 10 mL XVIVO-10 medium (Lonza #(BE)BP04-743Q ...
-
bioRxiv - Cancer Biology 2024Quote: ... Cells were confirmed as negative for mycoplasma contamination by using a Lonza Mycoplasma Detection Kit (Lonza Bioscience, Durham, NC) before injection ...
-
bioRxiv - Genetics 2024Quote: ... 1.25 × 104 HRCE cells were plated in a 96-well plate in renal epithelial growth media (Lonza, CC-3190). 24 hours later cells were transfected with 50ng regulatory element plasmid and 50ng Renilla plasmid (pGL 4.74 ...
-
bioRxiv - Neuroscience 2024Quote: Nucleofections were done on cortical neurons using the P3 Primary Cell 4D-Nucleofector X Kit (Lonza, LZ-V4XP-3024), on the day of preparation and dissociation (DIV 0) ...
-
bioRxiv - Bioengineering 2024Quote: Ribonucleoprotein (RNP) complexes were delivered into HEK293T cells via a 4D-Nucleofector® X Unit (Lonza, Cat# AAF-1003X) in a strip format using SF Cell Line 4D-Nucleofector™ X Kit S (Lonza ...
-
bioRxiv - Neuroscience 2024Quote: ... and 300μM single stranded oligodeoxynucleotides (ssODN: 5’gggtccagggtggctgtcactcat ccttttttctggctaccaaaggtgcagataattaaGaagaagctggatcttagcaacgtccagccaagtgtggctcaaaggataatatc aaacacgtcc 3’) and the P3 Primary Cell 4D reaction mix (Lonza). We screened a minimum of 96 clones for genetic editing ...
-
bioRxiv - Molecular Biology 2024Quote: ... Cells were verified as negative for mycoplasma by testing with the MycoAlert Mycoplasma Detection Assay kit (Lonza, LT07–318) per the manufacturer’s instructions.
-
bioRxiv - Molecular Biology 2024Quote: ... Cell culture media supernatant was tested for mycoplasma contamination every 4lJweeks using the MycoAlert PLUS mycoplasma detection kit (Lonza) and all tests were negative throughout the experiments.
-
bioRxiv - Cell Biology 2024Quote: ... Virus-containing medium was harvested (P0) after 72 hours for infection of 106 cells in Insect-Express medium (Lonza) to be cultured at 28°C while constant shaking ...
-
bioRxiv - Cancer Biology 2021Quote: ... All cell lines were routinely tested for mycoplasma contamination using the MycoAlert™ PLUS Mycoplasma Detection Kit (Lonza LT07-710).
-
Tuning trophoblast invasion in a gelatin hydrogel via soluble cues from the maternal-fetal interfacebioRxiv - Bioengineering 2020Quote: ... Routine mycoplasma testing was performed every 6 months to ensure cell quality using the MycoAlert™ Mycoplasma Detection Kit (Lonza).
-
bioRxiv - Cell Biology 2021Quote: ... Marrow cells were resuspended in 10 mL α – MEM and subjected to density centrifugation using 20 mL Lymphoprep™ (Lonza) at 800 x g for 20 minutes with no braking on the centrifuge ...
-
bioRxiv - Bioengineering 2021Quote: ... 1.0×106 clonal Kp03 landing pad cells were electroporated in 100 μL Amaxa solution (Lonza Nucleofector 2b, program T-016) with 1 μg of PiggyBac expression vector (PB200A-1 ...
-
bioRxiv - Cancer Biology 2021Quote: ... 2.5·104 stably GFP-expressing PC3 cells were added to the osteoblasts and co-cultured in α-MEM medium (Lonza) supplemented with 10% FBS ...
-
bioRxiv - Cell Biology 2020Quote: ... Primary XP168LV (XP-C patient cells) were transfected with siRNAs and subsequently serum starved for at least 24 hrs in F10 medium (Lonza) supplemented with 0.5% FCS and antibiotics ...
-
bioRxiv - Cell Biology 2020Quote: ... cell monolayers were washed twice in sterile D-PBS and cells were detached with Trypsin 0.5 g/L EDTA 0.2 g/L (Lonza, # BE17-161E) for 5 minutes ...
-
bioRxiv - Immunology 2021Quote: ... WT RAW264.7 cells were subjected to two rounds of nucleofection with Cas9-RNPs using the SF Cell Line 4D-Nucleofector X Kit S (Lonza) and the 4D Nucleofector apparatus precisely as specified by the manufacturer ...
-
bioRxiv - Developmental Biology 2021Quote: ... Constructs containing validated gRNAs were electroporated together with a vector expressing puromycin into hESCs using the P3 Primary Cell 4D-Nucleofector X kit (Lonza) following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... were electroporated with 20 ug of guide plasmid and 60 ug of linearized repair plasmid using an Amaxa 4D electroporator and P3 Primary cell 4D Nucleofector X Kit L (Lonza) using programme FP158 as described (Collins et al. ...
-
bioRxiv - Immunology 2022Quote: ... Thawed PBMCS were rested for 3-4h at 37°C in X-VIVO 15 Serum-free Hematopoietic Cell Medium (Lonza) supplemented with 5% human Ab serum ...
-
bioRxiv - Neuroscience 2021Quote: ... Cells were resuspended and transfected by combining 5×105 viable cells with 400 ng plasmid DNA and nucleofection solution in a 25 µL electroporation cuvette (Lonza). Electroporation of GCaMP mutants was performed according to the manufacturer’s protocol.
-
bioRxiv - Molecular Biology 2021Quote: ... cells were washed with 1X phosphate buffered saline (PBS) and resuspended in 20 µL of solution SF or SE (Lonza). Cell suspensions were combined with RNP complex(es) ...
-
bioRxiv - Cell Biology 2022Quote: ... to create pSpCas9(BB)-2A-GFP-ghMyo10 as described previously [88].Two days after transfection of WT HeLa cells with pSpCas9(BB)-2A-GFP-ghMyo10 using Amaxa nucleofection (Lonza), GFP-positive cells were subjected to single-cell sorting into 96-well plates using a BD FACS cell sorter ...
-
bioRxiv - Cell Biology 2022Quote: ... 90 μL of nucleofection solution (16.2 μL of Supplement solution mixed with 73.8 μL of SF solution from SF Cell Line 4D-Nucleofector™ X Kit L) (Lonza) was mixed thoroughly with the cell pellet ...
-
bioRxiv - Genomics 2020Quote: LNCAP (ATCC) and PC3 (ATCC) cells were cultured and maintained in RPMI media supplemented with 10% fetal bovine serum (FBS; Lonza) 1mM sodium pyruvate (Gibco ...
-
bioRxiv - Immunology 2021Quote: ... 10×106 CD8+ T cells were resuspended in 250 µL of RT red phenol-free serum-free TheraPEAKTM X-VIVOTM-15 (BEBP02-061Q, Lonza). 10 µg of RNA coding for the α and β chains of the TCR recognizing the S7C epitope of NY-ESO-1 presented on HLA-A*02:01 (NY-ESO (157-165) ...
-
bioRxiv - Molecular Biology 2019Quote: ... POLE3 and POLE4 gene knockouts were generated in RPE1-hTERT Flag-Cas9 TP53-/- cells by electroporation of LentiGuide-Puro or LentiGuide-NLS-GFP vectors using an Amaxa II Nucleofector (Lonza). C16orf72 gene knockout clones were generated in RPE1-hTERT Flag-Cas9 TP53-/- cells by transfecting sgRNA/Cas9 ribonucleoprotein complex using Lipofectamine CRISPRMAX Cas9 Transfection Reagent (Invitrogen) ...
-
bioRxiv - Genetics 2020Quote: ... All nucleofections were performed using 106 freshly-purified CD4 T cells in 100 μl nucleofection buffer using a Nucleofector 2b device (Lonza), based on previous optimisation studies (data not shown) ...
-
bioRxiv - Developmental Biology 2019Quote: ... U2OS cells were transfected with Cas9 and guide RNA expression plasmids using Amaxa electroporation as recommended by the manufacturer (Lonza). Cas9 expression plasmid was from the Church lab (Addgene 41815) ...
-
bioRxiv - Biochemistry 2019Quote: ... 3×107 cells were transfected with 10 μg of NotI linearized plasmids using the AMAXA electroporator (Lonza, program X-001) as described [14] ...
-
bioRxiv - Molecular Biology 2019Quote: ... was modified by adding T2A-GFP at the C-terminal end and electroporated with the sgRNA vector into JB1 and BJ1 hybrid ES cells using the Amaxa nucleofector procedure (Lonza). 24 h post-electroporation ...
-
bioRxiv - Cancer Biology 2020Quote: Bioluminescent detection of cellular ATP as a measure of cell viability was undertaken using ViaLight® Plus Kit (Lonza Inc.) reagents ...