Labshake search
Citations for Lonza :
3401 - 3450 of 4130 citations for Cytomegalovirus Cell Lysate Antigen since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2023Quote: ... MECP2 knock out HAP1 cells from Horizon Discovery (Cat: HZGHC001102c010, RRID: CVCL_SX72) were cultured in IMDM ((Lonza, 12-722F) supplemented with 10% FBS (VWR 97068-085 ...
-
bioRxiv - Cancer Biology 2024Quote: ... and resuspended in 20 µL of SF Cell Line Nucleofector™ Solution with the supplement added (Lonza V4XC-2032). The cells and the RNP complex were carefully mixed and transferred to a well of the 16-well Nucleocuvette™ ...
-
bioRxiv - Molecular Biology 2024Quote: ... 33 μL of cell suspension was mixed with 66 μL of solution 1 (0.83% low-melting-point agarose SeaPlaque GTG (Lonza), 170 mM sorbitol ...
-
bioRxiv - Immunology 2023Quote: ... The precomplexed HDR-RNP complex was electroporated into primary human T cells as described above using P3 buffer (Lonza). The T cells were cultured in T cell media with 300 IU/ml IL-2 for 7-10 days ...
-
bioRxiv - Genomics 2023Quote: ... Cells were grown at 37°C and 5% CO2 and passed with Hepes buffered saline solution (Lonza, CC-5024) and 0.25% Trypsin-EDTA (Gibco ...
-
bioRxiv - Neuroscience 2023Quote: ... All CRISPR reagents were electroporated into iPSCs using the P3 Primary Cell 4D Nucleofector™ X Kit S (Lonza), as previously described.(25 ...
-
bioRxiv - Bioengineering 2023Quote: Primary human alveolar epithelial cells (HPAECs, CellBiologics) were cultured at 37°C and 5% CO2 with SABM medium (Lonza), SAGM supplements (Lonza) ...
-
bioRxiv - Cancer Biology 2023Quote: Invasion assays were performed using human bronchial epithelial cells grown on collagen discs containing primary human pulmonary fibroblasts (Lonza Bioscience ...
-
bioRxiv - Microbiology 2023Quote: Human airway tracheobronchial epithelial cells isolated from airway specimens from donors without underlying lung disease were provided by Lonza, Inc ...
-
bioRxiv - Immunology 2023Quote: ... The sgRNA complexes were then added to 1×106 NK92 cells resuspended in 16uL of P3 nucleofection buffer (Lonza). The nucleofection mixture was transferred to a 16-well strip for nucleofection in the Lonza 4D Nucleofector using the pulse code CM-138 ...
-
bioRxiv - Biochemistry 2023Quote: Plasma cholesterol was depleted by treating HEK293 cells with 5 mM MβCD for 30 min in Pro293A-CDM (Lonza); this short period of MβCD treatment was deemed sufficient to removed 50% of endogenous cholesterol from cells (34) ...
-
bioRxiv - Neuroscience 2023Quote: ... We regularly monitored all cell cultures for mycoplasma contamination using the MycoAlert™ Mycoplasma Detection Kit (Lonza, #LT07-218).
-
bioRxiv - Bioengineering 2023Quote: ... with two phosphothiorate linkages on each end were mixed with 82 µL Nucleofector Solution V and 18 µL of Supplement Solution 1 according to manufacturer’s recommendations for the Cell Line Nucleofector Kit V (Lonza). 5×105 U2OS.EGFP parent cells were resuspended in the above mixture and nucleofected with a Lonza Nucleofector 2b Device (Kit V ...
-
bioRxiv - Bioengineering 2024Quote: ... Human primary bone marrow MSCs derived by plastic adherence of mononucleated cells from human bone marrow aspirate donors (Lonza) and were cultured in α-minimal essential medium (αMEM ...
-
bioRxiv - Molecular Biology 2024Quote: ... once the cell confluency reached 90% the culture medium was changed to 10 mL XVIVO-10 medium (Lonza #(BE)BP04-743Q ...
-
bioRxiv - Cancer Biology 2024Quote: ... Cells were confirmed as negative for mycoplasma contamination by using a Lonza Mycoplasma Detection Kit (Lonza Bioscience, Durham, NC) before injection ...
-
bioRxiv - Molecular Biology 2024Quote: ... Plasmids were transfected into human U2OS cells (ATCC HTB-96) by Amaxa electroporation with Nucleofector™ Kit V (Lonza) and plated in 6 well plates containing glass slides.
-
bioRxiv - Biochemistry 2024Quote: ... the media supernatant was removed and we washed the cells with 2 ml of prewarmed 1xDPBS (Lonza, 17-512F). The PBS was then removed and cells were then incubated at 37°C in 250 μL of trypsin (Corning ...
-
bioRxiv - Genetics 2024Quote: ... 1.25 × 104 HRCE cells were plated in a 96-well plate in renal epithelial growth media (Lonza, CC-3190). 24 hours later cells were transfected with 50ng regulatory element plasmid and 50ng Renilla plasmid (pGL 4.74 ...
-
bioRxiv - Cancer Biology 2024Quote: ... Human umbilical vein endothelial cells (HUVEC; C2519A) and normal human lung fibroblasts (nhLF; CC-2512) were purchased from Lonza and cultured in coated flasks with 50 μg/ml rat tail collagen I (Roche) ...
-
bioRxiv - Neuroscience 2024Quote: Nucleofections were done on cortical neurons using the P3 Primary Cell 4D-Nucleofector X Kit (Lonza, LZ-V4XP-3024), on the day of preparation and dissociation (DIV 0) ...
-
bioRxiv - Bioengineering 2024Quote: Ribonucleoprotein (RNP) complexes were delivered into HEK293T cells via a 4D-Nucleofector® X Unit (Lonza, Cat# AAF-1003X) in a strip format using SF Cell Line 4D-Nucleofector™ X Kit S (Lonza ...
-
bioRxiv - Neuroscience 2024Quote: ... and 300μM single stranded oligodeoxynucleotides (ssODN: 5’gggtccagggtggctgtcactcat ccttttttctggctaccaaaggtgcagataattaaGaagaagctggatcttagcaacgtccagccaagtgtggctcaaaggataatatc aaacacgtcc 3’) and the P3 Primary Cell 4D reaction mix (Lonza). We screened a minimum of 96 clones for genetic editing ...
-
bioRxiv - Molecular Biology 2024Quote: ... Cells were verified as negative for mycoplasma by testing with the MycoAlert Mycoplasma Detection Assay kit (Lonza, LT07–318) per the manufacturer’s instructions.
-
bioRxiv - Molecular Biology 2024Quote: ... Cell culture media supernatant was tested for mycoplasma contamination every 4lJweeks using the MycoAlert PLUS mycoplasma detection kit (Lonza) and all tests were negative throughout the experiments.
-
bioRxiv - Cell Biology 2024Quote: ... Virus-containing medium was harvested (P0) after 72 hours for infection of 106 cells in Insect-Express medium (Lonza) to be cultured at 28°C while constant shaking ...
-
bioRxiv - Cancer Biology 2021Quote: ... All cell lines were routinely tested for mycoplasma contamination using the MycoAlert™ PLUS Mycoplasma Detection Kit (Lonza LT07-710).
-
Tuning trophoblast invasion in a gelatin hydrogel via soluble cues from the maternal-fetal interfacebioRxiv - Bioengineering 2020Quote: ... Routine mycoplasma testing was performed every 6 months to ensure cell quality using the MycoAlert™ Mycoplasma Detection Kit (Lonza).
-
bioRxiv - Cell Biology 2021Quote: ... Marrow cells were resuspended in 10 mL α – MEM and subjected to density centrifugation using 20 mL Lymphoprep™ (Lonza) at 800 x g for 20 minutes with no braking on the centrifuge ...
-
bioRxiv - Bioengineering 2021Quote: ... 1.0×106 clonal Kp03 landing pad cells were electroporated in 100 μL Amaxa solution (Lonza Nucleofector 2b, program T-016) with 1 μg of PiggyBac expression vector (PB200A-1 ...
-
bioRxiv - Cancer Biology 2021Quote: ... 2.5·104 stably GFP-expressing PC3 cells were added to the osteoblasts and co-cultured in α-MEM medium (Lonza) supplemented with 10% FBS ...
-
bioRxiv - Microbiology 2020Quote: Human retinal pigmented epithelium ARPE-19 cells [American Type Culture Collection (ATCC) CRL-2302] were grown in a 1:1 (v/v) mixture of DMEM (Lonza) and Ham’s F12 (Gibco ...
-
bioRxiv - Cell Biology 2020Quote: ... RNP complex was added to ssDNA GATA4 V267M repair template (IDT) and delivered to wildtype iPSCs by electroporation with the Amaxa human stem cell nucleofector starter kit (Lonza). Following electroporation ...
-
bioRxiv - Cell Biology 2020Quote: ... Primary XP168LV (XP-C patient cells) were transfected with siRNAs and subsequently serum starved for at least 24 hrs in F10 medium (Lonza) supplemented with 0.5% FCS and antibiotics ...
-
bioRxiv - Cell Biology 2020Quote: ... cell monolayers were washed twice in sterile D-PBS and cells were detached with Trypsin 0.5 g/L EDTA 0.2 g/L (Lonza, # BE17-161E) for 5 minutes ...
-
bioRxiv - Immunology 2021Quote: ... WT RAW264.7 cells were subjected to two rounds of nucleofection with Cas9-RNPs using the SF Cell Line 4D-Nucleofector X Kit S (Lonza) and the 4D Nucleofector apparatus precisely as specified by the manufacturer ...
-
bioRxiv - Developmental Biology 2021Quote: ... Constructs containing validated gRNAs were electroporated together with a vector expressing puromycin into hESCs using the P3 Primary Cell 4D-Nucleofector X kit (Lonza) following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: ... the RNP complexes were added to 1×105 cells in 40 μl of P3 nucleofection buffer from the 4D-Nucleofector X kit (Lonza). Half of the mixture was loaded to each well of a 16-well nucleofection cassette and nucleofected using the using E0-100 program with the 4D-Nucleofector Lonza Amaxa ...
-
bioRxiv - Microbiology 2021Quote: ... were electroporated with 20 ug of guide plasmid and 60 ug of linearized repair plasmid using an Amaxa 4D electroporator and P3 Primary cell 4D Nucleofector X Kit L (Lonza) using programme FP158 as described (Collins et al. ...
-
bioRxiv - Immunology 2022Quote: ... a total of 1.6 x 108 cells were transfected with 2 μM of the corresponding ASO using the P3 Primary Cell 4D-Nucleofector X Kit L (Lonza) and the EO-115 program ...
-
bioRxiv - Cell Biology 2022Quote: hTERT immortalized RPE-1 (RPE1) cell lines were grown in an 1:1 mix of DMEM and F-10 (Lonza) and Human Embryonic Kidney (HEK ...
-
bioRxiv - Immunology 2022Quote: ... Thawed PBMCS were rested for 3-4h at 37°C in X-VIVO 15 Serum-free Hematopoietic Cell Medium (Lonza) supplemented with 5% human Ab serum ...
-
bioRxiv - Genomics 2020Quote: ... Transfection of these iPSCs with the plasmid and Super piggyBacTM transposase mRNA (Transposagen) was done using the Human Stem Cell Nucleofector Kit 1 (VAPH-5012) by Nucleofector 2b Device (AAB-1001, Lonza) according to the manual ...
-
bioRxiv - Neuroscience 2021Quote: ... Cells were resuspended and transfected by combining 5×105 viable cells with 400 ng plasmid DNA and nucleofection solution in a 25 µL electroporation cuvette (Lonza). Electroporation of GCaMP mutants was performed according to the manufacturer’s protocol.
-
bioRxiv - Molecular Biology 2020Quote: ... MBP-tagged TRIM21 (pFastBac-MBP-TRIM21) was expressed in SF9 insect cells in Lonza Insect-XPRESS according to standard protocols (Lonza). Cleared cell lysates were prepared by sonication of cell pellets in 50 mM Tris pH 8 ...
-
bioRxiv - Molecular Biology 2021Quote: ... cells were washed with 1X phosphate buffered saline (PBS) and resuspended in 20 µL of solution SF or SE (Lonza). Cell suspensions were combined with RNP complex(es) ...
-
bioRxiv - Molecular Biology 2020Quote: HUVECs were cultured in EGM™-2 Endothelial Cell Growth Medium-2 BulletKit™ (Lonza: CC-3156 and CC-4176) for 24 hours before transfecting with RNAiMax (Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2022Quote: ... to create pSpCas9(BB)-2A-GFP-ghMyo10 as described previously [88].Two days after transfection of WT HeLa cells with pSpCas9(BB)-2A-GFP-ghMyo10 using Amaxa nucleofection (Lonza), GFP-positive cells were subjected to single-cell sorting into 96-well plates using a BD FACS cell sorter ...
-
bioRxiv - Cell Biology 2022Quote: ... 90 μL of nucleofection solution (16.2 μL of Supplement solution mixed with 73.8 μL of SF solution from SF Cell Line 4D-Nucleofector™ X Kit L) (Lonza) was mixed thoroughly with the cell pellet ...
-
bioRxiv - Genomics 2020Quote: LNCAP (ATCC) and PC3 (ATCC) cells were cultured and maintained in RPMI media supplemented with 10% fetal bovine serum (FBS; Lonza) 1mM sodium pyruvate (Gibco ...