Labshake search
Citations for Lonza :
3651 - 3700 of 4130 citations for Cytomegalovirus Cell Lysate Antigen since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2024Quote: ... Cells were seeded at a density of 7500 cells in 6-cm3 tissue culture dish in duplicate in 0.8% SeaPlaque GTG agarose (Lonza 50111) mixed with Iscove’s Modified Dulbecco’s medium (Gibco 12200-036 ...
-
bioRxiv - Molecular Biology 2024Quote: ... 1 × 106 wild-type K562 cells were electroporated in 100 μl of Amaxa solution (Lonza Nucleofector 2b, program T-016) with 1 µg of PiggyBac expression vector (PB200A-1 ...
-
bioRxiv - Neuroscience 2024Quote: ... 2.5 × 10 5 phNPCs cells were used per electroporation reaction in one cuvette of the 16-well Nucleocuvette Stripe (Lonza). After trypsinization ...
-
bioRxiv - Molecular Biology 2024Quote: ... Retrovirally transfection with a MSCV-MLL/AF9-IRES-NeoR construct in sorted progenitor cells was performed a day after incubation in RPMI1640 (Lonza) transduction medium containing 10% (FBS ...
-
bioRxiv - Neuroscience 2024Quote: ... Four wells of EBs per line were seeded in a 4-layer cell discs coated with growth factor-reduced matrigel in X-VIVO15 medium (Lonza) supplied with GlutaMAX (Gibco) ...
-
bioRxiv - Cancer Biology 2024Quote: CRISPR-mediated mutagenesis was carried out by transiently introducing CRISPR/Cas9 RNA-nucleoprotein complex into cultured NB4 cells with the 4D-Nucleofector system (Lonza). The sample preparation kit was Lonza SF Cell Line 4D-Nucleofector Kit S (Cat# V4XC-2024) ...
-
bioRxiv - Cell Biology 2024Quote: ... Cells were passaged 1:10 every 3-4 days by trypsinisation and were regularly screened for mycoplasma contamination (Mycoalert, Lonza).
-
bioRxiv - Cancer Biology 2023Quote: ... MCF 10A cells were obtained from ATCC (Cat# CRL10317) and were grown in mammary epithelial growth media (Cat# CC-3150, Lonza) supplemented with cholera toxin (Cat# C8052 ...
-
bioRxiv - Bioengineering 2024Quote: ... are commonly used as an experimental model for human hearts due to their anatomical and structural similarities and convenient availability.36–38 Cells were cultured on tissue culture treated flasks with Endothelial Growth Medium-2 (EGM-2, Lonza), which was changed every other day until the cells reached ∼75% confluence ...
-
bioRxiv - Cell Biology 2023Quote: ... and Cas9-GFP were then transfected into human iPSCs for INS mutation correction using embryonic stem cell Nucleofector Kit (VVPH-5012, Lonza). Transfected cells were cultivated in StemFlex medium (catalog #A3349401 ...
-
bioRxiv - Cancer Biology 2024Quote: ... Cells were confirmed to be mycoplasma-free based on a luminescence-based enzymatic assay (MycoAlert®, Lonza, Cat# LT07-118) conducted within 1 week of the commencement and completion of the experiments ...
-
bioRxiv - Immunology 2024Quote: ... Plasmids were sequenced at the OHSU sequencing core and transfected into BEAS-2B MR1-/- cells using the Amaxa nucleofection system with Kit T solution (Lonza). The transfection efficiency was evaluated via GFP expression by flow cytometry (Supplementary Figure 4) ...
-
bioRxiv - Immunology 2024Quote: ... were nucleofected into 1e6 BEAS-2B WT cells at 300 nM according to the manufacturer’s instructions (Lonza, Nucleofector Kit T). Cells were allowed to rest overnight (TAPBPR and tapasin ...
-
bioRxiv - Immunology 2024Quote: The absence of Mycoplasma in the cell lines was routinely controlled using the MycoAlert mycoplasma detection kit (Lonza, LT07-318).
-
bioRxiv - Genomics 2024Quote: Transfections of DNA constructs in ESCs were performed using the P3 Primary Cell 4D-Nucleofector X Kit (V4XP-3024) and the Amaxa 4D Nucleofector system (Lonza). For each nucleofection ...
-
bioRxiv - Microbiology 2024Quote: Raw264.7 CRISPR cells were generated by electroporation of low passage Raw264.7 cells with Dhx58 and Ifih1 pSBtet-puro-Cas9-U6 using Amaxa Nucleofector II and Amaxa Cell Line Nucleofector Kit V (Lonza). Cells were selected with puromycin 3 days post-nucleofection ...
-
bioRxiv - Immunology 2024Quote: Ten micrograms of expression plasmid or 20 pmol of siRNA were introduced into 1 x 107 BMDC cells by electroporation using a Nucleofector 2b (Lonza) with an Amaxa Mouse Dendritic Cell Nucleofection Kit (Lonza) ...
-
bioRxiv - Immunology 2024Quote: ... The reaction contained 400 pmol of Cas9 protein and 1 × 107 of the transduced NK cells in 100 µL of P3 solution (Lonza). Immediately after electroporation ...
-
bioRxiv - Immunology 2024Quote: ... They were then transfected by nucleofection with 3 μg of plasmid DNA in 100 μl of Cell Line Nucleofector Solution V (Lonza) using the V-001 program (Amaxa Biosystems) ...
-
bioRxiv - Neuroscience 2023Quote: ... Cells were nucleofected with plasmids of interest using the Lonza 2b Nucleofector and Rat cardiomyocyte Nucleofector Kit (Lonza, VAPE-1002) according to the manufacturer’s instruction.
-
bioRxiv - Biochemistry 2023Quote: ... 200,000 H1299 cells were resuspended in the resulting solution containing ribonucleoprotein complexes (RNPs) and electroporated using a 4D-Nucleofector (Amaxa, Lonza). Nucleofected cells were then expanded and single-cell cloned by limiting dilution by plating 0.5 cells/well in a 96 well plate ...
-
bioRxiv - Neuroscience 2023Quote: ... Transfection of neuronal cells with pCAG-CaBLAM and pCAG-GeNL(Ca2+)_480 was done by electroporation using an Amaxa Nucleofection Device (Lonza) at day-in-vitro 0 (DIV0) ...
-
bioRxiv - Cell Biology 2024Quote: ... together with a plasmid encoding the piggyBac transposase in a 3:1 ratio (vector:transposase) using the P3 Primary cell 4D-Nucleofector™ kit (Lonza). Prior to targeting ...
-
bioRxiv - Cell Biology 2024Quote: ... The inoculum was removed two hours post infection and cells were covered with 0.4% SeaPlaque™ agarose (Lonza Group AG) in medium ...
-
bioRxiv - Cancer Biology 2024Quote: ... The OCI-LY3 cell line was cultured in IMDM with 25 mM HEPES and 2 mM L-glutamine (Lonza; Switzerland), supplemented with P/S ...
-
bioRxiv - Bioengineering 2024Quote: ... and activated using anti-human CD3/CD28 dynabeads (Cell Therapy Systems, Thermo) at a 1:1 ratio in XVivo 15 media (Lonza) supplemented with 5% FBS (MilliporeSigma ...
-
bioRxiv - Bioengineering 2024Quote: ... B cells were edited 3-5 days after isolation or thawing using the Lonza Nucleofector 4D (program EO-117) using 1×106 cells per well of a 16-well Nucleocuvette Strip (Lonza). Immediately following nucleofection ...
-
bioRxiv - Immunology 2022Quote: ... Three-five million cells were combined with 200 pMol siRNA (siControl or siME1) in 20 μl P3 nucleofection media (Lonza) per well of the 16-well Nucleocuvette strips (X unit) ...
-
bioRxiv - Immunology 2022Quote: ... Red blood cells from the collected blood or from the single cell suspension of the cardiac tissue were removed via treatment with a hypotonic lysis buffer (Lonza). Cells were then washed and the following antibodies were used for flow cytometry ...
-
bioRxiv - Biophysics 2023Quote: ... the ASMC_1 and ASMC_2 cells were transferred into a T-75 flask for an entire week in the growth medium (SmGM-2, Lonza). The cells were incubated at 37°C and 5% CO2 to maintain the pH at 7.2-7.4 ...
-
bioRxiv - Cancer Biology 2023Quote: Cell and organoid lines were generated from C3-TAg tumors (supplementary file 1) and tested for mycoplasma (Lonza, LT07-703) prior to use and the creation of frozen stocks ...
-
bioRxiv - Neuroscience 2023Quote: ... 01F49i-N-B7 iPSCs were dissociated to single cells and 250,000 cells transfected with 25 μL of the prepared transfection mix containing 20 µL of nucleofection buffer (P3 Primary Cell 4D-NucleofectorTM X Kit S, Lonza), 5 µL of the RNP complex ...
-
bioRxiv - Immunology 2023Quote: CRISPR–Cas9 gene knockout was performed by transient Cas9/gRNA (RNP) complex electroporation using the P3 Primary Cell 4D-Nucleofector X Kit S (Lonza). On day 4 of culture ...
-
bioRxiv - Molecular Biology 2022Quote: ... cells were resuspended in 90 µL of nucleofection solution (16.2 µL of Supplement solution mixed with 73.8 µL of SF solution from SF Cell Line 4D-Nucleofector™ X Kit L) (Lonza), transferred to the 15 µL RNP solution ...
-
bioRxiv - Cell Biology 2023Quote: BCi-NS1.1 cells (passage 17-25) (kind gift of Dr. Ronald Crystal) and Normal Human Bronchial Epithelial cells (NHBE) (cat. no. CC-2541, Lonza, lot numbers 623950 ...
-
bioRxiv - Molecular Biology 2023Quote: ... the paired RNPs were combined and nucleofected into 4×105 Raw 264-7 cells suspended in 10 ul of nucleofection buffer (Lonza) using the program DS-136 in a 4D Nucleofector X Unit (Lonza) ...
-
bioRxiv - Molecular Biology 2023Quote: ... complexes for each peak to be deleted were prepared individually by mixing 120 pmol of sgRNA with 20 pmol of Cas9 protein (QB3 MacroLab, University of California, Berkeley) in 5 ul of P3 primary cell nucleofection buffer (Lonza) and incubated at room temperature for 15 minutes ...
-
bioRxiv - Microbiology 2023Quote: ... Knock-down procedures were performed with siRNA purchased from Riboxx (non-targeting siRNA: UUGUACUACACAAAAGUACCCCC; US10 targeting #1: UUCUGAAUAACACAGCCGCCCCC) applying the SE Cell Line Kit (Lonza) for fibroblasts and Lipofectamine RNAiMax (Invitrogen ...
-
bioRxiv - Developmental Biology 2023Quote: ... 5.0-8.0 × 105 BTAG cells were electroporated with 3 μg of each gRNA using Amaxa 4D nucleofector (Lonza, V4XP-3012) and the CA-137 program ...
-
bioRxiv - Molecular Biology 2023Quote: ... HeLa and SH-SY5Y cells were grown in Dulbecco’s modified Eagle medium with L-glutamine and 4.5 g/L glucose (DMEM; Lonza or Biowest) supplemented with 10% fetal calf serum (Gibco ...
-
bioRxiv - Cell Biology 2023Quote: ... 1.5-2.0 x 105 cells were electroporated with 200 pmol of protein in 20 µl cuvettes using a 4D nucleofector device (Lonza) according to the manufacturer’s recommendations ...
-
bioRxiv - Cell Biology 2023Quote: ... All sorted and parental cell lines were confirmed to be mycoplasma-negative in a MycoAlert PLUS assay (Lonza, LT07-710) performed by the Koch Institute High-Throughput Sciences Facility (Cambridge ...
-
bioRxiv - Microbiology 2023Quote: ... amazonensis promastigotes using the Human T-Cell Nucleofector kit and the Amaxa Nucleofector electroporator (program U-033, Lonza, Basel, Switzerland), for integration into the 18S rRNA locus within the nuclear DNA ...
-
bioRxiv - Bioengineering 2023Quote: ... iPSC and T cell electroporation were performed using the Amaxa™ 96-well Shuttle™ with the 4D Nucleofector (Lonza). Cas9 nucleases and sgRNAs were precomplexed in supplemented Nucleofector® Solution for 20 min at room temperature and the RNP solution was made up to a final volume of 2.5 µL (10X) ...
-
bioRxiv - Immunology 2023Quote: ... Transfections were performed with an Amaxa Nucleofector device: 2×106 cells were resuspended in 100 μL Nucleofector solution T (Lonza) and added to 2 µg of pcDNA3.1 expression vector encoding full-length IL-2Rβ ...
-
bioRxiv - Cell Biology 2023Quote: ... This plasmid and plasmid pSPCas9(BB)-2A-puro(PX459)-hMyo10 above were transfected together into HeLa cells using an Amaxa nucleofection apparatus (Lonza). Five days later the cells were subjected to single-cell sorting into 96-well plates ...
-
bioRxiv - Cancer Biology 2023Quote: ... All cell lines were routinely tested for mycoplasma contamination using a MycoAlert PLUS Mycoplasma Detection Kit (#LT07-710, Lonza, Switzerland).
-
bioRxiv - Genomics 2023Quote: ... 5 µg of the 4sgRNA plasmid or 10 µM synthetic guide RNAs were mixed and the cell/reagent/nucleofection mix was transferred to Nucleofection cuvette strips (Lonza). Cells were electroporated using a 4D nucleofector (4D-Nucleofector Core Unit ...
-
bioRxiv - Genetics 2023Quote: ... the assembled ribonucleoprotein complexes were added to non-attached primary hepatocytes in suspension at 1x106 cells / mL in HCM media (Lonza). Cells were incubated with rocking at 37°C for 2 hours before transplantation ...
-
bioRxiv - Immunology 2023Quote: ... at bead-to-cell ratio of 1:1 in human IL-2 medium (X-VIVO 15, serum-free hematopoietic cell medium, with 2mM L-Glutamine and gentamicin (Lonza) supplemented with 5% Human AB serum (Valley Medical) ...