Labshake search
Citations for Qiagen :
2251 - 2300 of 10000+ citations since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2024Quote: DNA was extracted using the DNeasy PowerWater Kit (QIAGEN) following manufacturer’s instructions with a few modifications ...
-
bioRxiv - Microbiology 2024Quote: ... Total DNA was extracted from 50.0 mg of fresh ground tissue using the DNeasy® Plant Pro® Kit (Qiagen, Germantown, Maryland, USA), following manufacturer instructions ...
-
bioRxiv - Microbiology 2024Quote: ... using a 2 ml Tube Holder Set (QIAGEN; Cat. No. 11993), and DNA extractions were eluted with C6 Elution Buffer in a final volume of 80 µl ...
-
bioRxiv - Microbiology 2024Quote: DNA was extracted from samples using the QIAamp PowerFecal Pro DNA Kit (QIAGEN; Cat. No. 51804) from 300 µl of stool sample according to manufacturer’s instructions ...
-
bioRxiv - Microbiology 2024Quote: ... were combined from each individual and minced in a combination of 300 µL of body fluid and 300 µL blood using a TissueLysser II (Qiagen). In addition ...
-
bioRxiv - Microbiology 2024Quote: ... with the QuantiTect Multiplex PCR kit (Qiagen) according to manufacturer’s instructions ...
-
bioRxiv - Microbiology 2024Quote: ... Supernatant was passed over 8 ml of Ni-NTA resin (Qiagen), and the resin was washed with 70 ml of lysis buffer supplemented to 1 M NaCl followed by 20 ml lysis buffer ...
-
bioRxiv - Molecular Biology 2024Quote: ... DNA was digested on column using RNase-Free DNase Set (Qiagen 79254). RNA was reverse transcribed using High-Capacity cDNA Reverse Transcription kit with RNase Inhibitor (Applied Biosystems 4374966 ...
-
bioRxiv - Molecular Biology 2024Quote: ... and RNeasy Mini purification kit (Qiagen 74104) according to manufactures protocols ...
-
bioRxiv - Microbiology 2024Quote: ... Recombinant proteins were purified to near homogeneity (>95%) using Ni-chelate affinity chromatography on Ni-NTA Superflow resin (Qiagen) using standard protocols ...
-
bioRxiv - Microbiology 2024Quote: ... Lysates were clarified by centrifugation at 21,000× g at 4°C and loaded onto gravity flow Ni-NTA agarose columns (Qiagen), followed by washing with 50 mM HEPES pH 7.5 ...
-
bioRxiv - Microbiology 2024Quote: ... The genomic DNA extraction was done with the ONT recommended Qiagen genomic DNA extraction kit (QIAGEN Genomic-tip 500/G cat: 10262). The protocol for bacterial DNA isolation was performed ...
-
bioRxiv - Microbiology 2024Quote: ... pascuorum weevils for individual DNA extractions using a Qiagen DNeasy Blood and Tissue kit (Qiagen, Germany) following manufacturer’s protocol ...
-
bioRxiv - Microbiology 2024Quote: ... Genomic DNA was isolated with a DNeasy Blood and Tissue Kit (Qiagen) and submitted to Novogene (Sacramento ...
-
bioRxiv - Microbiology 2024Quote: ... cell pellets were resuspended in Qiagen P2 Lysis Buffer (Qiagen Sciences, Germantown, MD, Cat. 19052) for cell lysis ...
-
bioRxiv - Microbiology 2024Quote: ... RNA was purified using the RNeasy Minikit (Qiagen), following the clean-up protocol ...
-
bioRxiv - Microbiology 2024Quote: As outlined by the REPLI-g cell WGA & WTA handbook from Qiagen, 8 µL of lysis buffer was added to 13 µL of the final RNA fraction of interest and was incubated at 24 °C for 5 minutes followed by 95 °C for 3 mins and cooled down at 4 °C ...
-
bioRxiv - Microbiology 2024Quote: ... As outlined by the QIAseq FastSelect 5S/16S/23S rRNA handbook from Qiagen, 1.5 µL of 12 µL FastSelect FH Buffer ...
-
bioRxiv - Microbiology 2024Quote: ... Lysates were centrifuged for 30 min at 30000 x g in 4 °C and the resulting supernatants were gently mixed with Ni-NTA Agarose beads (Qiagen) pre-equilibrated with lysis buffer ...
-
bioRxiv - Microbiology 2024Quote: ... The plasmids were isolated using a Plasmid Mini Kit (Qiagen), sequenced using Sanger sequencing (Eurofins Genomics ...
-
bioRxiv - Microbiology 2024Quote: ... As outlined by Qiagen quick-start protocol (2017) ...
-
bioRxiv - Microbiology 2024Quote: ... the microbial DNA extraction was performed using a DNeasy PowerSoil Pro Kit (Qiagen, Germany), according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2024Quote: ... a QIAseq FastSelect kit (Qiagen Sciences, Maryland, MD, USA) was used for rapid removal of bacterial and mammalian rRNA ...
-
bioRxiv - Microbiology 2024Quote: D2Y98P RNA genome was extracted using QIAamp Viral RNA Kits (Qiagen). Complementary DNA (cDNA ...
-
bioRxiv - Microbiology 2024Quote: ... Further RNA extraction was then performed using RNeasy mini kit (Qiagen) as per manufacturer’s protocol.
-
bioRxiv - Microbiology 2024Quote: ... Fragments were gel-purified with MinElute gel extraction Kit (Qiagen) after agarose gel electrophoresis and blunt end cloning was performed into pCR™-Blunt II-TOPO™ Vector (Invitrogen) ...
-
bioRxiv - Microbiology 2024Quote: ... Mycelia were ground in the constant presence of liquid nitrogen and RNA was isolated using the RNeasy Plant Mini Kit (Qiagen) following the manufacturer’s instructions and including the on column DNAse digestion step ...
-
bioRxiv - Molecular Biology 2024Quote: ... samples were further concentrated and purified with the RNeasy MinElute Cleanup Kit (Qiagen: 74804). PE150 reads were generated with the Illumina NovoSeq platform ...
-
bioRxiv - Microbiology 2024Quote: ... the virus stock was first treated by RNase to remove the extra-cellular RNA and continued to viral RNA extraction (QIAamp Viral RNA Kits, Qiagen). 10 μL of viral RNA was added into 20 μL reverse transcription reaction using MBTuni-12 as the primer and high-fidelity reverse transcriptase (SuperScript III ...
-
bioRxiv - Microbiology 2024Quote: DNA from the vaginal specimens were extracted according to validated in-house laboratory protocols using QIAamp® DNA Mini Kit (QIAGEN, Maryland, USA) and the X-tractor Gene® DNA workstation (QIAGEN ...
-
bioRxiv - Microbiology 2024Quote: ... and the X-tractor Gene® DNA workstation (QIAGEN, Maryland, USA) with slight modifications ...
-
bioRxiv - Microbiology 2024Quote: Total microbial DNA from biofilms and planktonic cells of dental plaque cultures was extracted using DNeasy PowerSoil kit (Qiagen; Germantown, MD). After the recommended quality control procedures ...
-
bioRxiv - Microbiology 2024Quote: ... The viral RNA product was then treated by DNase to remove the carry-over plasmid DNA (RNeasy Kit, Qiagen). cDNA of the virus genome was generated by reverse transcription with random hexamer as the primer (SuperScript III ...
-
bioRxiv - Microbiology 2024Quote: ... 140 μL virus supernatant was treated with 0.25 μg RNaseA for 30 min in 37 °C to remove the extracellular RNA and continued with viral RNA extraction (QIAamp Viral RNA Kits, Qiagen) following the manufacture’s protocol ...
-
bioRxiv - Microbiology 2024Quote: ... and the plasmids were purified using Ultra-Pure Miniprep kits (Qiagen) for use in transfections.
-
bioRxiv - Microbiology 2024Quote: ... 140 μL virus supernatant was treated with 0.25 μg RNaseA for 30 min in 37 °C and continued with viral RNA extraction (QIAamp Viral RNA Kits, Qiagen) following the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2024Quote: ... Genomic DNA was extracted from the soil or the suspensions from the reactors using DNeasy PowerSoil Pro Kit (Qiagen, Hilden, Germany) according to the protocol provided by the manufacturer ...
-
bioRxiv - Microbiology 2024Quote: ... Viral RNA was isolated by QIAamp Viral RNA Mini Kit (Qiagen, Cat#52904). The DNA was used to measure the HIV-1 reservoir using IPDA (Bruner et al. ...
-
bioRxiv - Microbiology 2024Quote: ... or QIAamp DNA Mini Kit (Qiagen, Cat#51304). Viral RNA was isolated by QIAamp Viral RNA Mini Kit (Qiagen ...
-
bioRxiv - Microbiology 2024Quote: ... DNA was extracted either by Allprep (Qiagen, Cat#80204) or QIAamp DNA Mini Kit (Qiagen ...
-
Hepatitis B Virus genomes associate with cellular sites of DNA damage by inducing replication stressbioRxiv - Microbiology 2024Quote: ... precipitated in isopropanol and resuspended in 100 μL of Buffer EB (Qiagen). Inverse PCRs were performed on the BglII-NlaIII fragments on the HBV genome using with inverse PCR primers tgccttctgacttctttccttcagt and cagtagctccaaattctttataaggg ...
-
bioRxiv - Microbiology 2024Quote: ... RNA samples were prepared by using RNeasy Mini kits (Qiagen), followed by DNA depletion with Turbo DNase (Ambion ...
-
bioRxiv - Microbiology 2024Quote: Genomic DNA was extracted using DNeasy Blood & Tissue Kit (Qiagen) following manufacturer’s instructions for tissues with a slight modification ...
-
bioRxiv - Microbiology 2024Quote: ... DNA extraction (DNeasy PowerSoil Pro Kit, Qiagen) confirmed the presence of M ...
-
bioRxiv - Microbiology 2024Quote: ... Viral RNA extraction was performed using a QIAamp Viral RNA Mini Kit (Qiagen). The first-strand cDNA synthesis used for reverse transcription (RT) ...
-
bioRxiv - Microbiology 2024Quote: ... 200ng of RNA was used for reverse transcription using the QuantiTect Reverse Transcription Kit (Qiagen) according to manufacturer’s instructions ...
-
bioRxiv - Microbiology 2024Quote: The multiplex real-time qPCR assays were carried out in Rotor-Gene Q (Qiagen). A primer mix (200 µl ...
-
bioRxiv - Microbiology 2024Quote: ... The DNA was extracted from the healthy and greenhouse inoculated plants using DNeasy Plant Mini Kit (Qiagen), according to manufacturer’s instructions with an additional step of using a Mini-Bead Beater 16 Center Bolt (Biospec products ...
-
bioRxiv - Microbiology 2024Quote: ... We applied this mixture to a RNeasy Mini spin column and extracted RNA according to the manufacturer’s instructions using a RNeasy Mini Kit (Qiagen 74106). We performed on-column DNase digestion using the RNase-Free DNase Set (Qiagen 79254) ...
-
bioRxiv - Microbiology 2024Quote: ... We added 700 μl of Buffer RLT (Qiagen 79216) to each sample and vortexed vigorously for 5 to 10 seconds ...