Labshake search
Citations for Qiagen :
2251 - 2300 of 10000+ citations since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2024Quote: ... Illumina compatible libraries were generated using the Qiagen Q1ASeq 1-step amplicon kit (Qiagen, #180419), and sequencing was performed on the Illumina MiSeq platform using 2×250 paired end reads with a goal of generating 5,000 – 10,000 reads per sample ...
-
bioRxiv - Immunology 2024Quote: ... DNA extraction was performed using the QIAmp PowerFecal Pro DNA Kit (Qiagen, #51804).
-
bioRxiv - Microbiology 2024Quote: Pre-designed small interfering RNAs (siRNAs) and the non-target control (negative control) AllstarNeg were from Qiagen. 2×104 HeLa cells were reverse transfected with 10 nM siRNA using Lipofectamine RNAiMax (Life Technologies ...
-
bioRxiv - Microbiology 2024Quote: RNA extraction was performed using RNeasy Kit (Qiagen) according to supplier’s instructions ...
-
bioRxiv - Microbiology 2024Quote: ... Genomic DNA for some isolates was extracted using DNeasy Blood & Tissue Kit (Qiagen), according to the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2024Quote: ... the DNA was purified using DNeasy Blood and Tissue kit (Qiagen) following the standard protocol ...
-
bioRxiv - Microbiology 2024Quote: ... mixed with 1 mL phenol:chloroform:isoamyl alcohol (25:24:1 at pH 8) at 70°C for 12 min and bead beating for 2 min (Tissue Lyser II, Qiagen). The mixture was centrifuged at 4°C for 3 min at maximum speed and the aqueous phase was transferred to a new reaction tube ...
-
bioRxiv - Microbiology 2024Quote: ... PLY432 genomic DNA was extracted using the DNeasy Blood and Tissue Kit (Qiagen). The V4-V5 region of the 18S rRNA gene was amplified from purified genomic DNA using the 18S universal primers (574F-CGGTAAYTCCAGCTCYAV and 1192R-CAGGTGAGTTTTCCCGTGTT ...
-
bioRxiv - Microbiology 2024Quote: Genomic DNA was extracted using the Qiasymphony DSP DNA Midi Kit on the Qiasymphony system (Qiagen, UK) to manufacturer’s instructions ...
-
bioRxiv - Microbiology 2024Quote: ... Cell pellets were resuspended in 450 µl RLT buffer (QIAGEN, Hilden, Germany) with 1% β-mercaptoethanol ...
-
bioRxiv - Microbiology 2024Quote: Total RNA was extracted from 239 individual swab sample using the RNeasy Plus universal mini kit (QIAGEN) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2024Quote: ... respectively (Qiagen, Germany), following a modified version of the manufacturer’s instructions in the case of filters (Chiang and Inostroza ...
-
bioRxiv - Microbiology 2024Quote: ... Plasmids were purified with the QIAprep Spin Miniprep Kit (QIAGEN, Hilden, Germany).
-
bioRxiv - Microbiology 2024Quote: ... Plasmid DNA was extracted using QIAprep Spin Miniprep Kit (Qiagen, Germantown MD USA) and used to transform E ...
-
bioRxiv - Microbiology 2024Quote: ... Material was ruptured two times for 1 min at 30 Hz in a TissueLyser (Qiagen Inc., Germantown, MD, USA). Between and after these two steps of tissue disruption ...
-
bioRxiv - Microbiology 2024Quote: ... Fungal DNA was extracted using a Qiacube robot with the DNeasy Plant Pro Kit 69206 (Qiagen).
-
bioRxiv - Microbiology 2024Quote: ... Cells were washed three times with PBS to eliminate unbound FVVs and RNAs were extracted using RNeasy plus mini kit (Qiagen) according to manufacturer’s protocol ...
-
bioRxiv - Microbiology 2024Quote: ... The purified RNA was ultimately resuspended in RNase-Free Water (QIAGEN), and its concentration was determined at 260 nm using a NanoDrop ND-1000 spectrophotometer ...
-
bioRxiv - Microbiology 2024Quote: ... RNA was extracted using the RNeasy Mini Kit (Qiagen), and genomic DNA was removed using the TURBO DNA-free kit (Invitrogen) ...
-
bioRxiv - Microbiology 2024Quote: ... with the RNA protect Bacteria reagents (QIAGEN), following the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2024Quote: Genomic DNA extraction was carried out on 250 μl of fecal samples using the DNeasy PowerSoil Kit (QIAGEN, USA) according to the manufacturer’s protocol with a slight modification as previously described (Kumpitsch et al.) ...
-
bioRxiv - Microbiology 2024Quote: ... Assembly was performed with the CLC Genomics workbench v.20 (CLC Bio, Qiagen), including the Microbial Genomics Pro Suite module ...
-
bioRxiv - Microbiology 2024Quote: ... this was reverse transcribed to cDNA using the Quantitect Reverse Transcription Kit (Qiagen, Germany). To obtain a more complete library ...
-
bioRxiv - Microbiology 2024Quote: ... with the QuantiTect Multiplex PCR kit (Qiagen) according to manufacturer’s instructions ...
-
bioRxiv - Microbiology 2024Quote: ... Parasite genomic DNA was purified from the blood of a transfer mouse using the Qiagen QIAamp DNA Blood Kit (Qiagen, Cat# 51106), and genotyping PCR was performed to assess integration into the target locus ...
-
bioRxiv - Microbiology 2024Quote: ... The cDNA copy number in a small aliquot of each sample was measured on a QIAcuity digital PCR (dPCR) system (Qiagen) using forward primer ACGTGGTGTTTATTACCCTGACA ...
-
bioRxiv - Microbiology 2024Quote: ... or QIAprep Spin Miniprep Kit (QIAGEN). For GFP2 and GFP4 vectors successfully cloned enhancer constructs were further isolated with ZymoPure II Maxiprep kit (Zymo research).
-
bioRxiv - Microbiology 2024Quote: ... the DNA was isolated with the EZ1 DNA Tissue kit on the BioRobot EZ1 robot (Qiagen, Hombrechtikon, Switzerland).
-
bioRxiv - Microbiology 2024Quote: ... DNA was extracted using the DNeasy Blood & Tissue Kit (Qiagen) and resuspended in 100 μl ...
-
bioRxiv - Microbiology 2024Quote: ... 24 and 44 hpi and DNA was extracted using DNAeasy blood and tissue kit (Qiagen). Genome copy number quantitation was done by quantitative polymerase chain reaction (qPCR ...
-
bioRxiv - Microbiology 2024Quote: Bacterial genomic DNA was extracted separately from caecal tissue (∼100 mg) and caecal contents (∼200 mg) using a QIAamp Fast DNA Stool Mini kit (QIAGEN, Valencia, CA, USA) following the manufacturer’s pathogen detection protocol ...
-
bioRxiv - Microbiology 2024Quote: ... Genomic DNA were purified following manufacturer instruction for Gram-positive bacteria (DNeasy Blood and Tissue – Qiagen) and sequenced (Illumina sequencing at Core facility or Eurofins Genomics) ...
-
bioRxiv - Microbiology 2024Quote: ... DNA extraction was performed utilizing commercial kits and following manufacturer’s protocol (Qiagen’s DNeasy 96 Blood & Tissue Kit, Qiagen). The amount and quality of extracted DNA was evaluated using PicoGreen fluorometer and NanoDrop spectrophotometer (ThermoFisher Scientific) ...
-
bioRxiv - Microbiology 2024Quote: ... Bacteria are harvested by centrifugation (5 minutes, 4°C) and washed with 1 ml cold PBS containing RNA stabilization reagents (RNAprotect, Qiagen) before flash freezing and storage at -80°C ...
-
bioRxiv - Microbiology 2024Quote: ... PCR products were purified using the QIAquick Gel Extraction Kit (Qiagen). Restriction enzymes and T4 DNA ligase were purchased from NEB ...
-
bioRxiv - Microbiology 2024Quote: Depletion of rRNA (FastSelect Bacterial, Qiagen), libraries construction (TruSeq Stranded mRNA ...
-
bioRxiv - Microbiology 2024Quote: ... DNA extraction was performed utilizing commercial kits and following manufacturer’s protocol (Qiagen’s DNeasy 96 Blood & Tissue Kit, Qiagen). The amount and quality of extracted DNA was evaluated using PicoGreen fluorometer and NanoDrop spectrophotometer (ThermoFisher Scientific) ...
-
bioRxiv - Microbiology 2024Quote: ... Genomic DNA of isolated colony were purified from 7.5 ml of culture (DNeasy Blood and Tissue – Qiagen) with an additional step of cell lysis with microbeads (Precellys Evolution) ...
-
bioRxiv - Microbiology 2024Quote: ... coli using the QIAprep Spin Miniprep Kit (Qiagen). All plasmids made by PCR cloning were sequenced by Azenta ...
-
bioRxiv - Microbiology 2024Quote: ... The DNA-free RNA was concentrated by MinElute Cleanup kit (Qiagen). The rRNA depletion ...
-
bioRxiv - Microbiology 2024Quote: ... Ni-NTA slurry (Qiagen) (0.8 ml bed volume ...
-
bioRxiv - Microbiology 2024Quote: ... The QIAamp DNA Mini and Fast Cycling kits (QIAGEN, UK) were used for DNA extraction and PCR amplification ...
-
bioRxiv - Microbiology 2024Quote: ... RNA was extracted using the RNeasy plus bacteria kit (Qiagen) according to manufacturer indications ...
-
Hepatitis B Virus genomes associate with cellular sites of DNA damage by inducing replication stressbioRxiv - Microbiology 2024Quote: ... precipitated in isopropanol and resuspended in 100 μL of Buffer EB (Qiagen). Inverse PCRs were performed on the BglII-NlaIII fragments on the HBV genome using with inverse PCR primers tgccttctgacttctttccttcagt and cagtagctccaaattctttataaggg ...
-
bioRxiv - Microbiology 2024Quote: ... RNA samples were prepared by using RNeasy Mini kits (Qiagen), followed by DNA depletion with Turbo DNase (Ambion ...
-
bioRxiv - Microbiology 2024Quote: Genomic DNA was extracted using DNeasy Blood & Tissue Kit (Qiagen) following manufacturer’s instructions for tissues with a slight modification ...
-
bioRxiv - Microbiology 2024Quote: DNA extraction was performed using the DNeasy PowerSoil Pro Kit (Qiagen, Toronto, Canada) according to kit protocols ...
-
bioRxiv - Microbiology 2024Quote: ... DNA was extracted using the DNeasy PowerSoil Pro Kit (Qiagen, Toronto, Canada) according to kit protocols ...
-
bioRxiv - Microbiology 2024Quote: ... followed by rotation of the adapter and ten additional minutes of bead beating using a TissueLyser II (QIAGEN; Cat. No. 85300) using a 2 ml Tube Holder Set (QIAGEN ...
-
bioRxiv - Microbiology 2024Quote: LAMP reactions (final volume of 25 µl) were performed in Rotor-Gene Q (Qiagen, Germatown, MD). The reaction mixture contained 15 µl of Optigene Master Mix (Optigene ...