Labshake search
Citations for Qiagen :
2451 - 2500 of 10000+ citations since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2024Quote: RM tissue was collected as described above from mice and lysed in Buffer RLT (Qiagen) + 1% beta-mercaptoethanol (Sigma ...
-
bioRxiv - Microbiology 2024Quote: ... with ReadyMade PrimeTime primers for SPI1 (Integrated DNA Technologies Inc, USA) and RT2 qPCR Primer Assay for Human GAPDH (cat# PPH00150F-200, Qiagen). Expression was quantified using ABI Sequence Detection software compared to serial dilutions of an SPI1 or GAPDH synthetic sequence gBlock (Integrated DNA Technologies Inc ...
-
bioRxiv - Microbiology 2024Quote: ... 1.5x105 Acanthamoeba castellanii cells were transfected with 6 μg of linearized plasmid using Polyfect (QIAGEN) in phosphate saline buffer (PBS) ...
-
bioRxiv - Microbiology 2024Quote: ... anti-strep tag (Qiagen, 34850), anti-6*his tag (Thermo Fisher Scientific,11533923) ...
-
bioRxiv - Microbiology 2024Quote: Total RNA was extracted from blood and tissue samples using RNeasy Mini Kits (Qiagen) using previously established modifications to the kit protocol 35 ...
-
bioRxiv - Microbiology 2024Quote: ... transwell membranes were submerged in 375 µl Buffer RLT (Qiagen) and cell lysate was frozen at -80°C for future RNA extraction.
-
bioRxiv - Microbiology 2024Quote: ... Tissues collected at necropsy were stored in either Buffer RLT (Qiagen) or 10% Neutral Buffered Formalin (NBF).
-
bioRxiv - Immunology 2024Quote: ... Total RNA was extracted using the RNeasy Plus Universal Kit (Qiagen, Netherlands). Residual genomic DNA was removed using TURBO DNase (Life Technologies ...
-
bioRxiv - Immunology 2024Quote: ... Ribosomal RNA was depleted from the total RNA using QIAseq fast select multi-RNA removal kit for mouse RNA(Qiagen) and then RNAseq libraries were made using NEB Next Ultra II Directional RNA library prep kit for Illumina ...
-
bioRxiv - Immunology 2024Quote: Total RNA from 80 000 mTECs or cTECs was isolated using TRIzol and purified with an RNeasy micro kit (Qiagen). Total RNA was quantified using Qubit (Thermo Scientific) ...
-
bioRxiv - Microbiology 2024Quote: ... the mastermix was prepared according to the manufacturer’s recommendations given by the Quantinova SYBR Green PCR Kit (Qiagen, Germany), and forward and reverse primers added (0.5 µM each ...
-
bioRxiv - Microbiology 2024Quote: ... A Tissue lyser (Qiagen, Germany) was then used for homogenization (2 × 2 min at 50 Hz with a 2 min break in between) ...
-
bioRxiv - Microbiology 2024Quote: ... and 10 zirconium beads were added to approximately 5 mg of intestinal tissue stored at -80 °C in RNA later tissue reagent (Qiagen, Germany). A Tissue lyser (Qiagen ...
-
bioRxiv - Microbiology 2024Quote: ... the QIAmp Fast DNA Stool Mini Kit (Qiagen, Germany) was used to extract and purify DNA from colon content ...
-
bioRxiv - Microbiology 2024Quote: ... and real-time reverse transcription quantitative PCR (qRT-PCR) was performed using QuantiNova™ SYBR Green PCR Kit (Qiagen, Hilden, Germany). Primers were synthesized by IDT Inc ...
-
bioRxiv - Microbiology 2024Quote: ... RNA was isolated using RNeasy (Qiagen, Germantown, MD) mini spin columns ...
-
bioRxiv - Cancer Biology 2024Quote: ... the Dneasy Blood and Tissue kit (QIAGEN, Hilden, Germany), Wizard Genomic DNA purification kits (Promega ...
-
bioRxiv - Developmental Biology 2024Quote: ... Amplicons were purified using the MinElute PCR Purification kit (Qiagen). Then ...
-
bioRxiv - Plant Biology 2024Quote: Total DNA was extracted from 0.25 g of soil using the DNA PowerSoil PRO KIT (QIAGEN) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2024Quote: Total RNA was extracted from siNT and siPITAR cells using the Trizol method (Qiagen). RNA quality was assessed using an Agilent TapeStation system ...
-
bioRxiv - Cancer Biology 2024Quote: ... RNA was isolated from cell pellets and tumour fragments following the kit manufacturer’s protocol (Qiagen RNeasy, # 74104). 500 ng RNA was used for cDNA synthesis (SuperScript VILO MasterMix ...
-
bioRxiv - Plant Biology 2024Quote: ... and resupended in 50 μl RNAse-free water (Qiagen).
-
bioRxiv - Plant Biology 2024Quote: ... and purified using a MinElute PCR purification kit (Qiagen).
-
bioRxiv - Plant Biology 2024Quote: ... and positive clones (as identified by Sanger sequencing of positive colony PCR products) were used to generate purified plasmid DNA with a Plasmid Midi Kit (Qiagen).
-
bioRxiv - Evolutionary Biology 2024Quote: ... Plasmid DNAs were purified using the Qiaprep spin Miniprep (Qiagen) and verified by Sanger sequencing using internal gene-specific and vector primers to ensure overlapping sequence information in both forward and reverse directions ...
-
bioRxiv - Neuroscience 2024Quote: Total RNA from cultures was isolated using the RNeasy Micro Kit (Qiagen, #74004) and quantified using a NanoDrop ...
-
bioRxiv - Neuroscience 2024Quote: ... and HiPerFect transfection reagent (Qiagen, #301704). The knockdown was achieved using four different siRNAs each at 50 nM (Table 3 ...
-
bioRxiv - Cancer Biology 2024Quote: Cells were collected and lysed with RLT buffer and total RNA was extracted using the RNeasy Mini kit (Qiagen, #74104), according to the manufacturer’s protocol.
-
bioRxiv - Biophysics 2024Quote: ... as per the manufacturer’s instructions (Qiagen, cat# 20021).
-
bioRxiv - Biophysics 2024Quote: ... or RNAeasy (Qiagen) kits.
-
bioRxiv - Biophysics 2024Quote: ... or subjected to immunoblotting with either Penta·His (1:1,000; QIAGEN) or Anti-c-Myc (1:5,000 ...
-
bioRxiv - Bioengineering 2024Quote: ... we utilized the RT2 Profiler PCR Array - Pig Fibrosis (Qiagen, Gene GlobeID: PASS-120ZD). RNA samples were isolated and purified as previously described ...
-
bioRxiv - Genomics 2024Quote: ... and quantified it using QIAseq Library Quant Assay kit (Qiagen, Hilden, Germany) on a LightCycler 480 quantitative PCR (Roche ...
-
bioRxiv - Microbiology 2024Quote: ... Genomic DNA was isolated from the parent and suppressors using a DNeasy Blood and Tissue Kit (Qiagen) as per the manufacturer’s instructions ...
-
bioRxiv - Genetics 2024Quote: ... All other samples were extracted using the BioSprint (QIAGEN) method and diluted to 25 ng/μl and stored at −20°C ...
-
bioRxiv - Genomics 2024Quote: Total RNA was extracted using the RNeasyⓇ Plus Mini Kit (Qiagen; 74134) according to manufacturer’s instructions ...
-
bioRxiv - Immunology 2024Quote: ... DNA surrounding the sgRNA target site was amplified by PCR (STX4-1F: ACAAGGTGGTTAAGGTGGCA; STX4-1R: CTGTTCACAGGGAGACCGAC) and purified using the QIAquick PCR Purification Kit (Qiagen) per manufacturer’s protocols ...
-
bioRxiv - Cancer Biology 2024Quote: ... total RNA was isolated from three independent biological replicates using the Qiagen RNeasy Mini kit (Qiagen), according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2024Quote: ... RNA was prepared from PBMCs using the RNeasy Mini Kit (Qiagen, Germany), retro-transcribed in cDNA ...
-
bioRxiv - Cancer Biology 2024Quote: RNA was isolated using the miRNeasy kit from QIAGEN including an on-column deoxyribonuclease treatment ...
-
bioRxiv - Immunology 2024Quote: ... DNA was isolated from STX4 KO clones and BEAS-2B.Cas9 control cells using the QIAamp DNA Micro Kit (Qiagen) per manufacturer’s protocols ...
-
bioRxiv - Biochemistry 2024Quote: ... were expressed in SF9 cells and purified by affinity (Ni-NTA, Qiagen) followed by size exclusion (Superdex 200 ...
-
bioRxiv - Bioengineering 2024Quote: ... Cleared lysate was applied to a Ni-NTA column (Qiagen) and eluted using DPBS containing 250 mM imidazole.
-
bioRxiv - Biophysics 2024Quote: ... Samples were transferred to the RNeasy column (Qiagen #74106) and centrifuged ...
-
Autism genes converge on microtubule biology and RNA-binding proteins during excitatory neurogenesisbioRxiv - Systems Biology 2024Quote: Total RNAs were extracted from cells using RNeasy Mini Kit (Qiagen, Cat#74106) and were converted into cDNA using SUPERSCRIPT IV VILO MASTERMIX (Thermofisher Scientific ...
-
bioRxiv - Zoology 2024Quote: ... the QIAseq FX DNA Library Kit (Qiagen) was used ...
-
bioRxiv - Zoology 2024Quote: ... involved proteinase K digestion at 55°C using 20 µl of proteinase K and 220 µl of ATL lysis buffer (MinElute Reaction Cleanup kit, Qiagen). Prior digestion ...
-
bioRxiv - Zoology 2024Quote: ... followed by the removal of adaptor sequences and the filtration of polyclonal and low-quality reads (<55 bases long) using CLC Workbench (Qiagen). Overlapping paired-end (PE ...
-
bioRxiv - Zoology 2024Quote: ... the samples were thoroughly washed with nuclease-free water (Qiagen). The incubation time for proteinase K digestion varied depending on the tissue type and sample preservation ...
-
bioRxiv - Biophysics 2024Quote: ... The columns were washed with 500 μl of RW1 buffer and treated with DNase (Qiagen #79254) for 30 minutes at room temperature ...