Labshake search
Citations for Qiagen :
2001 - 2050 of 10000+ citations since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2024Quote: Cells were lysed with Buffer RLT Plus (Qiagen) containing 1% beta-mercaptoethanol (Sigma) ...
-
bioRxiv - Genomics 2024Quote: ... cells were lysed with buffer RLT Plus (Qiagen) containing 1% beta-mercaptoethanol (Sigma-Aldrich) ...
-
bioRxiv - Cancer Biology 2024Quote: ... loaded onto a Qiashredder column (Qiagen; #79656), and sheared by centrifugation at 21300 g for 30 seconds ...
-
bioRxiv - Cancer Biology 2024Quote: ... DNA and RNA were isolated simultaneously from each section with the AllPrep DNA / RNA / miRNA kit (Qiagen Inc., Valencia, CA). All nucleic acid isolation from tissue sections was performed using a QIAcube automated sample preparation system according to the manufacturer’s instructions (Qiagen Inc. ...
-
bioRxiv - Cancer Biology 2024Quote: Frozen blood was thawed and resuspended in red blood cell lysis solution (Qiagen Inc., Valencia, CA). White blood cells were removed by centrifugation at 2000g for 5 mins and repeated until white blood cells were depleted ...
-
bioRxiv - Cancer Biology 2024Quote: ... followed by cell lysis and purification using immobilized metal-affinity chromatography (IMAC) in a Ni–NTA (Qiagen, Valencia, CA) column in binding buffer composed of 20 mM HEPES pH 7.25 ...
-
bioRxiv - Cell Biology 2024Quote: ... and RNA was extracted using RNeasy kit (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2024Quote: RNA from hippocampal cultures or tissue was extracted using the RNeasy Plus Mini Kit (Qiagen, Hilden, Germany) with extra DNase I digestion on the column ...
-
bioRxiv - Neuroscience 2024Quote: RNA extraction was performed on N=31 homogenized half-brain tissue aliquots using the RNeasy Plus Micro Kit (QIAGEN, Germantown, MD). Tissue aliquots were homogenized in 350 µl QIAGEN Buffer RLT Plus using a Qiagen TissueLyser LT and centrifuged for 3 min at maximum speed ...
-
bioRxiv - Neuroscience 2024Quote: ... then performed RNA cleanup using RNeasy MinElute Cleanup Kit (Qiagen). RNA quality was assessed using the Agilent Bioanalyzer RNA Pico chip ...
-
bioRxiv - Molecular Biology 2024Quote: We uploaded the differentially expressed genes of each contrast to QIAGEN IPA (QIAGEN Inc. ...
-
bioRxiv - Microbiology 2024Quote: ... the cell pellet was treated with RNAProtect (Qiagen) and RNA was isolated with Qiagen RNAEasy (#74104) ...
-
bioRxiv - Neuroscience 2024Quote: ... Total liver RNA was isolated by phenol-chloroform extraction and purified using the RNeasy Mini Kit (Qiagen, #74104). qPCR was performed as described below ...
-
bioRxiv - Cell Biology 2024Quote: ... The DNA constructs were then verified by Sanger sequencing and amplified by maxiprep (Qiagen #12162). Lentiviruses were produced by co-transfection of 293T/17 cells with pVSV-G and pdVPR29.1 plasmids ...
-
bioRxiv - Cell Biology 2024Quote: ... and Ni-NTA Agarose resin (Qiagen) was mixed with the supernatant to capture PGL-3 protein molecules ...
-
bioRxiv - Cell Biology 2024Quote: ... and Ni-NTA Agarose resin (Qiagen) was mixed with the supernatant to capture PGL-3 protein molecules ...
-
bioRxiv - Cell Biology 2024Quote: Total RNA was extracted from freshly isolated AT2 cells using the RNeasy Micro Kit (Qiagen) and stored at -80°C ...
-
bioRxiv - Cell Biology 2024Quote: ... then treated with DNase II and mRNA was finally purified using RNeasy Mini Kit (Qiagen). For all the other experiments ...
-
bioRxiv - Cell Biology 2024Quote: ... Cells were transfected using Effectene transfection reagent (QIAGEN) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2024Quote: HEK293 cells were seeded in 15 cm plates and transfected after 24h according to manufacturer protocols (Effectene, Qiagen) using 5 µg of plasmid DNA ...
-
bioRxiv - Genetics 2024Quote: ... All other samples were extracted using the BioSprint (QIAGEN) method and diluted to 25 ng/μl and stored at −20°C ...
-
bioRxiv - Genomics 2024Quote: Total RNA was extracted using the RNeasyⓇ Plus Mini Kit (Qiagen; 74134) according to manufacturer’s instructions ...
-
bioRxiv - Immunology 2024Quote: ... DNA surrounding the sgRNA target site was amplified by PCR (STX4-1F: ACAAGGTGGTTAAGGTGGCA; STX4-1R: CTGTTCACAGGGAGACCGAC) and purified using the QIAquick PCR Purification Kit (Qiagen) per manufacturer’s protocols ...
-
bioRxiv - Cancer Biology 2024Quote: ... total RNA was isolated from three independent biological replicates using the Qiagen RNeasy Mini kit (Qiagen), according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2024Quote: ... RNA was prepared from PBMCs using the RNeasy Mini Kit (Qiagen, Germany), retro-transcribed in cDNA ...
-
bioRxiv - Cancer Biology 2024Quote: RNA was isolated using the miRNeasy kit from QIAGEN including an on-column deoxyribonuclease treatment ...
-
bioRxiv - Immunology 2024Quote: ... DNA was isolated from STX4 KO clones and BEAS-2B.Cas9 control cells using the QIAamp DNA Micro Kit (Qiagen) per manufacturer’s protocols ...
-
bioRxiv - Cell Biology 2024Quote: ... genomic DNA was isolated using the DNeasy blood and tissue kit (Qiagen, Valencia, CA, United States) and samples were analyzed using the human Illumina OMNI-EXPRESS-8v1.6 BeadChip ...
-
bioRxiv - Cell Biology 2024Quote: ... DNA was purified using QIAGEN PCR purification Kit (QIAGEN, 28106). Libraries were amplified for N-1 cycles (being N the optimum Cq determined by qPCR reaction ...
-
bioRxiv - Cell Biology 2024Quote: ... followed by column-based purification (Qiagen RNeasy Kit). cDNA was generated from 250-1000 ng of total RNA using an iScript™ cDNA Synthesis Kit (Bio-Rad Laboratories) ...
-
bioRxiv - Cell Biology 2024Quote: ... genomic DNA was extracted from cell pellets containing at least 1e6 cells/pellet using the DNeasy Blood and tissue kit (Qiagen), followed by bisulfite conversion using the Epitech Fast Bisulfite Conversion Kit (Qiagen) ...
-
bioRxiv - Cell Biology 2024Quote: ... The melting curves of amplified product DNA fragments were quantified against the methylation standard curve generated using commercial bisulfite converted human genomic DNAs (Qiagen) and expressed as a mean methylation percentage.
-
bioRxiv - Cell Biology 2024Quote: ... induced Tregs and primary Tconv was extracted using an RNA extraction kit (Qiagen) following differentiation (iPSC-Tregs and induced Tregs ...
-
bioRxiv - Cancer Biology 2024Quote: DNA isolation was performed using the Blood and Cell Culture DNA Mini Kit (QIAGEN). The isolated DNA samples were sent to the Center for Applied Genomics at the Children’s Hospital of Philadelphia for the SNP array analysis using the Infinium Global Screening Array-24 v3.0 Kit (Illumina) ...
-
bioRxiv - Cancer Biology 2024Quote: DNA was extracted from fresh frozen lung cancer tissue embedded into OCT (TissueTek, Sakura) and from PBMCs isolated from preserved patient-matched blood (AllPrep DNA/RNA extraction kit, Qiagen). Library construction was performed as previously described106 ...
-
bioRxiv - Cancer Biology 2024Quote: Total RNA from cell lines was extracted usingthe Qiagen RNeasy Mini kit (Qiagen, Hilden, Germany) following the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2024Quote: RNA isolation from the MIA PaCa-2 clones was performed by using the RNeasy Plus Micro Kit (QIAGEN). Libraries for RNA-seq were made with the NEBNext Ultra II Directional RNA Library Prep Kit for Illumina (NEB ...
-
bioRxiv - Cancer Biology 2024Quote: ... A total of 1 μg of total RNA from each sample was used to obtain double strand cDNA with the QuantiTect Reverse Transcription Kit (Qiagen). Quantitative Real-Time PCR (qRT-PCR ...
-
bioRxiv - Cancer Biology 2024Quote: Total RNA was purified from three biological replicates by Qiagen RNeasy Mini kit (Qiagen), according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2024Quote: RNA was extracted from cells using the QIAzol Lysis Reagent (Qiagen, Hilden, Germany) according to the user guidelines ...
-
bioRxiv - Cancer Biology 2024Quote: Total RNA was isolated using the RNeasy Mini Kit (Qiagen 74004) and cDNA was synthesized using the iScriptTM Reverse Transcription Supermix for RT-qPCR (Bio-Rad 1708840) ...
-
bioRxiv - Biochemistry 2024Quote: ... mapping and read summarization (counting only uniquely mapped paired reads) in CLC Genomics Workbench 10.0.1 (Qiagen, Hilden, Germany), with mapping parameters ...
-
bioRxiv - Genetics 2024Quote: ... and genomic DNA was extracted using a QIAamp DNA Blood Mini Kit (QIAGEN, Germany; 51126). The exomes of the subjects were captured by Agilent SureSelect Human All Exon V6 Enrichment kits (Agilent ...
-
bioRxiv - Cell Biology 2024Quote: ... followed by bisulfite conversion using the Epitech Fast Bisulfite Conversion Kit (Qiagen). The FOXP3 TSDR regions were then amplified from the converted sample gDNAs by qPCR using specific primers (forward ...
-
bioRxiv - Cancer Biology 2024Quote: ... RNA was isolated using RNEasy Mini kit (Qiagen, catalog number 74104).
-
bioRxiv - Cell Biology 2024Quote: ... a second transfection of a 0.6 μg plasmid encoding either the C-terminal GFP11 tagged M2tail(368-466) or M2 receptor was performed using the Effectene Transfection Reagent (Qiagen). After washing each well with 2 mL PBS ...
-
bioRxiv - Cell Biology 2024Quote: RNA was extracted and purified using QIAzol (Qiagen) and ReliaPrep RNA Cell MiniPrep System (Promega) ...
-
bioRxiv - Cell Biology 2024Quote: The samples were processed according to manufacturer protocols (Qproteome Mitochondria Isolation Kit, Qiagen). From the different steps were obtained three different fractions ...
-
bioRxiv - Cancer Biology 2024Quote: ... Plasmid DNAs were extracted with QIAGEN Plasmid Plus MIDI kit (QIAGEN 12941) for downstream applications.
-
bioRxiv - Cancer Biology 2024Quote: Genomic DNA was extracted from cell pellets by the QIAamp Blood Maxi Kit (Qiagen) and resuspended in Buffer EB (10 mM Tris–HCl [pH 7.5] ...