Labshake search
Citations for Qiagen :
1201 - 1250 of 1799 citations for Human UFL1 shRNA Plasmid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2023Quote: ... Plasmid DNA was obtained using the QIAprep Spin Miniprep Kit (Qiagen #27106, Hilden, Germany). Sanger sequencing was performed by SourceBioscience (Cambridge ...
-
bioRxiv - Microbiology 2023Quote: ... Plasmid from colonies growing in spectinomycin was extracted using QIAprep spin miniprep kit (QIAGEN) and introduction of the new guide was confirmed via Sanger sequencing ...
-
bioRxiv - Microbiology 2023Quote: ... Digested plasmid backbone and PCR product were gel extracted (QIAquick Gel Extraction Kit; Qiagen) and ligated for 2h at 24°C using T4 DNA ligase (Invitrogen) ...
-
bioRxiv - Molecular Biology 2023Quote: ... bacterial colonies were collected and isolated using the Plasmid Plus Midi Kit (Qiagen 12941). 20nt ...
-
bioRxiv - Synthetic Biology 2024Quote: ... extracted plasmid libraries were diluted to 0.5 ng/µL in Buffer EB (Qiagen, 19086) and Kapa Hifi HotStart Ready mastermix (Roche ...
-
bioRxiv - Synthetic Biology 2024Quote: ... 114269)34 and plasmid DNA was purified using the QIAprep Spin Miniprep Kit (Qiagen, 27104).
-
bioRxiv - Microbiology 2023Quote: ... The recombinant plasmid was purified using QIAgen mini prep kit (cat no.27106, Qiagen) as per manufacture’s protocol ...
-
bioRxiv - Microbiology 2023Quote: Plasmids were purified from overnight bacterial cultures using a QIAprep Spin Miniprep Kit (Qiagen). Polymerase chain reactions (PCR ...
-
bioRxiv - Immunology 2023Quote: ... DNA was purified from bacterial cultures using a HiSpeed Plasmid MidiPrep Kit (Qiagen, #12643), and cloned products were validated with whole-plasmid sequencing or Sanger sequencing of the insert ...
-
bioRxiv - Molecular Biology 2023Quote: Plasmid DNA was extracted from yeast using Qiagen QIAprep Spin Miniprep Kits (Qiagen, 27104). 500uL Resuspension Buffer PI was added to thawed pellets ...
-
bioRxiv - Molecular Biology 2023Quote: ... the cosmids were isolated using a Midiprep and a QIAfilter plasmid midi kit (QIAGEN). The cosmids were then digested for 2 hours at 37°C and heat-inactivated for 20 minutes at 80°C using SpeI-HF (New England Biolabs) ...
-
bioRxiv - Biophysics 2023Quote: ... isolated from large volumes of bacterial cultures using Endotoxin free Plasmid Purification kits (Qiagen). Linear PEI (25kDa ...
-
bioRxiv - Cancer Biology 2023Quote: ... Bacterial colonies were screened by PCR (F:CTCGACTAGGGATAACAGGG R:CAAAGAGATAGCAAGGTATTCAG) and successful plasmid clones miniprepped (Qiagen) and sequence verified by Sanger sequencing ...
-
bioRxiv - Synthetic Biology 2023Quote: ... we midi-prepped these cultures via alkaline lysis (Qiagen Plasmid Plus Midi-Prep Kit). This first cloning step enabled generation of intermediate products ...
-
bioRxiv - Immunology 2023Quote: ... and plasmids purified using a QIAprep Spin Miniprep Kit (Qiagen, Inc., Chatsworth, CA, USA). For analysis of the 5’ RACE products ...
-
bioRxiv - Cell Biology 2023Quote: ... Large-scale isolation of plasmid DNA was done using the QIAprep maxiprep kit (Qiagen) from 150 mL of overnight bacterial culture supplemented with appropriate antibiotics ...
-
bioRxiv - Plant Biology 2024Quote: ... and their plasmid DNA was extracted using the QIAprep Spin Miniprep Kit (Qiagen, USA). The pDNA from these colonies was pooled together and used to retransform new CA-free cells ...
-
bioRxiv - Genomics 2023Quote: ... All donor plasmids or fragments were column purified using a PCR purification kit (Qiagen) and eluted into injection buffer before injection ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... we isolated plasmids using a Qiagen QIAprep Spin Miniprep Kit (Qiagen, Germany, product #27104), following the manufacturer’s instructions apart from eluting the DNA in 30 uL of H2O instead of 50 uL of Elution Buffer ...
-
bioRxiv - Cell Biology 2023Quote: Plasmid DNA transfections in HEK293FT cells were performed using Effectene transfection reagent (#301425, QIAGEN), according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2023Quote: ... and plasmid extraction was followed by purification using the QIAprep Spin Miniprep Kit (Qiagen). Sequences were validated by Sanger sequencing (Eurofins Genomics) ...
-
bioRxiv - Cell Biology 2024Quote: ... Large-scale isolation of plasmid DNA was conducted using the QIAprep maxiprep kit (QIAGEN) from 150 mL overnight bacterial culture supplemented with appropriate antibiotics ...
-
bioRxiv - Cell Biology 2024Quote: ... Small-scale isolation of plasmid DNA was conducted using a QIAprep miniprep kit (QIAGEN) from 2 mL overnight bacterial culture supplemented with appropriate antibiotics ...
-
bioRxiv - Cell Biology 2024Quote: ... The digested plasmid was then purified using the QIAEXII Gel Extraction Kit (Qiagen, Q20021) and diluted to a final concentration of 100 ng/μL and ready for transformation.
-
bioRxiv - Cancer Biology 2021Quote: Total RNA from human and mouse kidney samples was harvested using the RNeasy Mini Kit (Qiagen). Total RNA isolation from cultured cells was extracted using Trizol reagent (Ambion ...
-
bioRxiv - Cell Biology 2020Quote: ... qPCR was performed using miRCURY LNA miRNA Human Panel I according to manufacturer’s instructions (Exiqon/Qiagen). The data was analyzed using GenEX software (MultiD ...
-
bioRxiv - Immunology 2021Quote: Pathway-specific primer mixes (Rat Antibacterial Response, PBR-148Z, and Human Antibacterial Response, PBH-148Z; Qiagen) were used for preamplification and qPCR arrays (Rat Antibacterial Response ...
-
bioRxiv - Molecular Biology 2021Quote: HeLa cells were transfected with 40 nM specific human RBM10-siRNA5 or control AllStar siRNA (Qiagen) using Lipofectamine 2000 (Invitrogen) ...
-
bioRxiv - Immunology 2021Quote: Genomic DNA was prepared from human or mouse B cells using QIAmp DNA Mini Kit (Qiagen), or from paraffin-embedded human IgD or IgA myeloma tissue sections (obtained from the University of Arkansas for Medical Science ...
-
bioRxiv - Cancer Biology 2020Quote: ... RNA from human cancer cells was extracted 48h post transfection using the RNeasy Kit from Qiagen according to the manufacturer’s instructions.
-
bioRxiv - Cancer Biology 2020Quote: Human cancer stem cells RT2 Profiler PCR arrays were purchased from Qiagen (Cat# PAHS-176ZA-12) and used in combination with a 7900 HT real-time PCR system (Applied Biosystems) ...
-
bioRxiv - Microbiology 2021Quote: ... while rodent and human samples were eluted in 100 µl of buffer AE (Qiagen, Hilden, Germany). Samples were stored at −20°C before PCR.
-
bioRxiv - Cell Biology 2022Quote: Total RNA was isolated from murine and human monocytes with the RNeasy Plus Micro Kit (Qiagen), and then 200 ng of RNA was reverse transcribed using the iScript RT Supermix (Bio-Rad) ...
-
bioRxiv - Genomics 2022Quote: ... cfDNA was then extracted from human blood plasma using the QIAmp Circulating Nucleic Acids kit (Qiagen), eluted in 60-μl elution buffer (10 mM Tris-Cl ...
-
bioRxiv - Immunology 2020Quote: Total RNA was extracted from mouse or human whole blood using RNA blood mini kit (Qiagen). Isolated RNA was converted to complementary DNA (cDNA ...
-
bioRxiv - Immunology 2020Quote: ... cDNA was added to the Human Toll-like receptor signaling pathway RT2 Profiler PCR array (Qiagen) and run on an iCycler MyiQ (Bio-Rad) ...
-
bioRxiv - Developmental Biology 2021Quote: ... Targets were included if biochemically confirmed using human tissue or non-species methods (sourced from QIAGEN’s curated Ingenuity Knowledge Base ...
-
bioRxiv - Immunology 2020Quote: ... RNA was extracted from purified human T cells using the RNeasy Plus Minikit (Qiagen, Germantown, MD). 0.5 μg Donor B RNA was mixed with 4.5 μg Donor A RNA to create sample C for quantitation experiments ...
-
bioRxiv - Molecular Biology 2021Quote: Total RNA was extracted from cultured human and mouse cells using an RNeasy Mini Kit (Qiagen) and included an on-column DNase treatment to eliminate contaminating genomic DNA ...
-
bioRxiv - Immunology 2022Quote: ... RNA was extracted from 5×106 human PBMCs from Cohort II using AllPrep RNEasy kits (Qiagen) and the small RNA-containing column flow-through collected ...
-
bioRxiv - Microbiology 2021Quote: Uninfected or infected primary human macrophages were subjected to RNA extraction using RNeasy Mini Kit (Qiagen) following manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: ... mouse organ lysates and human primary cell supernatant samples were prepared in RNeasy Mini Kit (Qiagen) lysis buffer RLT (400μl) ...
-
bioRxiv - Cancer Biology 2020Quote: ... human FLMs and adjacent normal tissue was performed using the AllPrep DNA/RNA Mini Kit (Qiagen). Whole exome sequencing was performed by Novogene using their standard protocols ...
-
bioRxiv - Pathology 2022Quote: ... Total RNA of mouse and human intestinal tissue was isolated using the RNeasy Mini Kit (Qiagen) and total RNA of mouse mesenteric fat was isolated using the RNeasy Lipid Tissue Mini Kit (Qiagen) ...
-
bioRxiv - Neuroscience 2022Quote: ... and human induced astrocytes (>day 30 of differentiation) were harvested in RLTplus Lysis buffer (Qiagen, 1053393). Total RNA was isolated using the RNeasy micro/mini plus kit (Qiagen ...
-
bioRxiv - Physiology 2023Quote: ... and grown to confluency and transfected with human Leptin constructs using Effectene kit (Cat# 301427, QIAGEN).
-
bioRxiv - Cell Biology 2024Quote: Total RNA was isolated from human primary immune cells using the RNeasy Plus Micro Kit (Qiagen). RNA integrity number (RIN ...
-
bioRxiv - Cancer Biology 2023Quote: gDNA was isolated from human sarcoma models and controls using the QIAamp DNA Mini Kit (Qiagen). Library preparation was performed by the Functional Genomics Laboratory (FGL) ...
-
bioRxiv - Cancer Biology 2023Quote: Total RNA was isolated from human sarcoma models and controls using the RNeasy Mini Kit (Qiagen). Library preparation was performed by the Functional Genomics Laboratory (FGL) ...
-
bioRxiv - Genetics 2024Quote: ... and aligned to a human reference sequence GRCh38/hg38 by using CLC Genomics Workbench v20 (Qiagen). The TPM (transcript per million ...