Labshake search
Citations for Qiagen :
1051 - 1100 of 1799 citations for Human UFL1 shRNA Plasmid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
Engineering of a fluorescent chemogenetic reporter with tunable color for advanced live-cell imagingbioRxiv - Molecular Biology 2021Quote: ... Small-scale isolation of plasmid DNA was done using QIAprep miniprep kit (Qiagen) from 2 mL overnight bacterial culture supplemented with appropriate antibiotics ...
-
bioRxiv - Physiology 2021Quote: ... Linearized plasmids and PCR fragments were gel purified using QIAquick columns (QIAGEN – 28115). PCR fragments and plasmid backbones were assembled using Gibson assembly (NEB – E2611) ...
-
bioRxiv - Biophysics 2021Quote: ... and the DNA was purified using a Qiafilter plasmid midi kit (Qiagen, 12243). Biotin-containing handles were made with a PCR on pBluescript SK+ (stratagene ...
-
bioRxiv - Microbiology 2021Quote: ... and plasmid DNA was purified from each sample (QIAprep Spin Miniprep Kits, QIAgen). All plasmid inserts were Sanger sequenced bi-directionally using M13 forward and reverse primers (Beijing Genome Institute (BGI ...
-
bioRxiv - Genetics 2021Quote: ... Linearized plasmids and PCR fragments were gel purified using QIAquick columns (Qiagen, #28115) and joined using either Gibson assembly (NEB ...
-
bioRxiv - Immunology 2022Quote: ... Vectors for hydrodynamic delivery were produced using the QIAGEN plasmid PlusMega kit (QIAGEN). Equivalent DNA concentration between different batches of DNA was confirmed to ensure reproducibility among experiments.
-
bioRxiv - Plant Biology 2022Quote: ... plasmids were rescued from yeast as described using the QIAprep Miniprep Kit (QIAGEN, Chadstone Centre ...
-
bioRxiv - Microbiology 2022Quote: ... Plasmid isolation was carried out using QIAprep Spin mini-prep kit (QIAgen, 27104) according to manufacturer instructions ...
-
bioRxiv - Microbiology 2022Quote: ... to remove template plasmid and subsequently purified (QIAquick PCR Purification Kit, Qiagen, Germany). Two gene fragments were synthesized (Twist Bioscience ...
-
bioRxiv - Synthetic Biology 2022Quote: ... Plasmid DNA preparation was carried out with the QIAprep Spin Miniprep Kit (Qiagen).
-
bioRxiv - Molecular Biology 2022Quote: ... Bacterial colonies were harvested and isolated using the Plasmid Plus Midi Kit (Qiagen). Four putative regulatory ...
-
bioRxiv - Molecular Biology 2022Quote: ... which was first prepared by using a Qiagen Plasmid Maxi Kit (12963, Qiagen) and further purified by CsCl equilibrium ultracentrifugation with ethidium bromide (Sambrook et al ...
-
bioRxiv - Synthetic Biology 2022Quote: ... Plasmid DNA was isolated from bacterial hosts using QIAprep Spin Miniprep kits (Qiagen).
-
bioRxiv - Cell Biology 2023Quote: ... Exemplary colonies were scaled up for plasmid isolation via midiPrep (Qiagen, Hilden, Germany). 293A cells were plated in 96-well cell culture plates at 30,000 cells/well in absence of antibiotics ...
-
bioRxiv - Developmental Biology 2022Quote: ... Plasmid was purified from selected colony using the QIAprep Spin Miniprep Kit (Qiagen), checked for insertion using restriction enzyme digest with Eco-RI (NEB ...
-
bioRxiv - Cell Biology 2023Quote: ... Small-scale isolation of plasmid DNA was done using QIAprep miniprep kit (Qiagen) from 2mL of overnight culture ...
-
bioRxiv - Plant Biology 2023Quote: ... Plasmids were purified from resulting colonies using QIAprep Spin Miniprep Kit (Qiagen, Germany). The final mutpMIR319C-P4P1R construct was generated by introducing mBS2 ...
-
bioRxiv - Microbiology 2023Quote: ... All plasmids were isolated with the QIAprep Spin Miniprep Kit (Qiagen ref# 27106) and eluted in molecular grade water (endotoxin free ...
-
bioRxiv - Cell Biology 2023Quote: ... then plasmids were extracted with the QIAprep Spin Miniprep Kit (QIAGEN, Hilden, Germany) following the manufacturer’s instructions.
-
bioRxiv - Cancer Biology 2023Quote: Plasmid DNA was extracted with a QIAprep Spin Miniprep Kit (#27104, QIAGEN, Netherlands) from bacterial cultures grown overnight in the presence of 100 µg/mL ampicillin (#A5354 ...
-
bioRxiv - Developmental Biology 2023Quote: ... cells were transfected with 10 µg plasmid DNA using Effectene transfection reagent (Qiagen). After an additional 24 hours ...
-
bioRxiv - Immunology 2023Quote: ... plasmid DNA was isolated from each clone using QIAprep 96 Turbo Kit (Qiagen) following the manufacturer’s protocol.
-
bioRxiv - Synthetic Biology 2023Quote: ... all plasmids underwent an additional PCR purification step using a QiaQuick column (Qiagen), which removed excess salt and were eluted and stored in nuclease-free water at 4 °C for short-term storage and -20 °C for long-term storage.
-
bioRxiv - Developmental Biology 2023Quote: ... Plasmids used for lipofection studies were prepared with a Qiagen Maxi kit (Qiagen).
-
bioRxiv - Biochemistry 2023Quote: ... Isolation of plasmids was done using QIAprep® Miniprep or Maxiprep kits (Qiagen) according to manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2023Quote: ... and plasmids were isolated from it using the QIAprep Spin Miniprep Kit (QIAGEN) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2023Quote: ... Small-scale isolation of plasmid DNA was done using QIAprep miniprep kit (Qiagen) from 2 mL overnight bacterial culture supplemented with appropriate antibiotics ...
-
bioRxiv - Synthetic Biology 2024Quote: ... all plasmids underwent an additional PCR purification step utilizing a QiaQuick column (Qiagen) to eliminate excess salt ...
-
bioRxiv - Microbiology 2023Quote: ... Plasmids were purified from each culture using the QIAprep Spin Miniprep Kit (Qiagen). The concentration and quality of the DNA were checked as previously described.
-
bioRxiv - Molecular Biology 2023Quote: ... Plasmid was isolated by an endotoxin-free DNA isolation method (Qiagen, Valencia, CA), or a similar DNA isolation method ...
-
bioRxiv - Neuroscience 2023Quote: ... followed by DNA extraction using a Qiagen plasmid mini kit (Qiagen, Crawley, UK), and the novel construct confirmed through Sanger Sequencing via Azenta/GENEWIZ (Azenta Life Sciences Inc. ...
-
bioRxiv - Cancer Biology 2023Quote: ... Eluted the DNA product in 0.1X EB (From QIAGEN Plasmid Plus Midi Kit) buffer ...
-
bioRxiv - Synthetic Biology 2023Quote: ... and plasmids were purified from cells using the QIAprep Spin Miniprep Kit (Qiagen). Sodium bromide was from MilliPoreSigma ...
-
bioRxiv - Genetics 2023Quote: ... Isolated colonies were inoculated and mini-prepped with the plasmid mini kit (QIAGEN). Inserted fragments were sequenced and confirmed (GENEWIZ) ...
-
bioRxiv - Cell Biology 2023Quote: ... Small-scale isolation of plasmid DNA was done using QIAprep miniprep kit (Qiagen) from 2 mL overnight bacterial culture supplemented with appropriate antibiotics ...
-
bioRxiv - Cell Biology 2023Quote: DNA was extracted from bacterial overnight cultures using Qiagen EndoFree Plasmid Kit (Qiagen). Plasmid DNA was stored in TE-Buffer and diluted to 1 μg/μl aliquots ...
-
bioRxiv - Cell Biology 2023Quote: ... and library plasmids were purified using a Qiagen HiSpeed Maxi kit (Qiagen, 12662). Plasmids were eluted in Buffer EB ...
-
bioRxiv - Developmental Biology 2023Quote: ... Plasmid purification was performed using QIAprep Spin Miniprep Kit (Catalog no. 27106, Qiagen) and NucleoBond Xtra Midi kit (Catalog no ...
-
bioRxiv - Molecular Biology 2024Quote: ... Plasmids were isolated from cultures using the QIAprep Spin Miniprep Kit (Qiagen, 27104).
-
bioRxiv - Neuroscience 2024Quote: ... Mini-preparations of plasmid constructs were isolated using QIAprep Spin Miniprep Kit (Qiagen). Proceeding sequence confirmation ...
-
bioRxiv - Molecular Biology 2024Quote: ... plasmid DNA was isolated using an endotoxin-free maxiprep kit (Qiagen, Germantown, MD). Plasmids were verified by Sanger sequencing (Genewiz ...
-
bioRxiv - Molecular Biology 2024Quote: ... and the DNA was purified using a QIAfilter Plasmid Midi Kit (Qiagen, 12243). Biotin-containing handles were made using a PCR on pBluescript SK+ (Stratagene ...
-
bioRxiv - Microbiology 2024Quote: ... Plasmid DNA was isolated from Escherichia coli using a Spin MiniPrep kit (Qiagen) and transferred to X ...
-
bioRxiv - Biophysics 2024Quote: ... Plasmid DNA isolation was performed using the QIAprep Spin Miniprep kit (Qiagen, #27104) following the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2024Quote: ... Plasmid DNA was extracted using QIAprep Spin Miniprep Kit (Qiagen, Germantown MD USA) and used to transform E ...
-
bioRxiv - Microbiology 2024Quote: ... Plasmid was extracted from each sample using the QIAprep Spin Miniprep Kit (Qiagen) following manufacturer’s protocol.
-
bioRxiv - Cell Biology 2020Quote: ... and 20 ng of cDNA used for qPCR with the human miFinder miRNA Array (Qiagen). The PCR was done with the following cycling conditions ...
-
bioRxiv - Developmental Biology 2020Quote: The following siRNAs were used for microinjection: human PLCB1 siRNA #1 (CACACTACCAAGTATAATGAA) (Qiagen, Hs_PLCB1_4, SI00115521); PLCB1 siRNA #2 (CAGAGATGATCGGTCATATA ...
-
bioRxiv - Biophysics 2019Quote: ... The human full-length GRASP55 was loaded on to the Ni-NTA superflow column (QIAGEN) and then eluted with 300 mM imidazole in lysis buffer ...
-
bioRxiv - Cancer Biology 2019Quote: ... Reads were mapped to the human genome (hg38) using CLC Genomics Workbench (Qiagen, Hilden, Germany) and data was analysed using HOMER (Hypergeometric Optimization of Motif EnRichment ...