Labshake search
Citations for Promega :
1801 - 1850 of 2354 citations for ssc mir 15a RT PCR Primer Set since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biophysics 2021Quote: ... Biotin-containing handles were made with a PCR on pBluescript SK+ (stratagene) with GoTaqG2 (Promega, M7845), in the presence of 1/5 biotin-16-dUTP (JenaBioscience ...
-
bioRxiv - Genomics 2021Quote: ... pSS-NLuc was created by PCR expansion of the target luciferase from pNL1.1 (Promega, Madison WI) into a vector containing the PCSK9 signal sequence from the same backbone (91) ...
-
bioRxiv - Genetics 2022Quote: ... the genomic DNA was used as a template for the PCR reactions using Go-Taq (Promega). The cycling consisted in initial denaturation ...
-
bioRxiv - Molecular Biology 2022Quote: ... End-point PCR to detect gene expression in mosquito tissues was performed using GoTaq polymerase (Promega) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2022Quote: ... the 16s rRNA gene region was PCR amplified with GoTaq Green Master Mix (Promega, Madison, WI), 16S rRNA gene primers 27F (AGAGTTTGATCMTGGCTCAG ...
-
bioRxiv - Microbiology 2022Quote: ... 1 μL of ligation product was amplified using PCR with a GO Taq DNA polymerase (Promega) and Illumina primers (P7 5’-CAAGCAGAAGACGGCATACGAGATAGACCGGGGACTTATCATCCAACCTGT-3’ ...
-
bioRxiv - Molecular Biology 2022Quote: ... This cDNA was also used for a conventional PCR using Go-Taq® Master Mix (Promega) with XBP1 splicing primers ...
-
bioRxiv - Microbiology 2022Quote: ... The resulting PCR product was cloned into the pGEM-T Easy vector system (Promega, WI, USA) and then digested with the restriction enzymes ...
-
bioRxiv - Microbiology 2022Quote: ... PCR was run with genomic DNA that was prepared with Wizard Genomic DNA Purification Kits (Promega).
-
bioRxiv - Molecular Biology 2022Quote: ... Colonies were screened by PCR screening using GoTaq G2 Hot Start green Master Mix (M7422, Promega) using the consensus pLKO F oligonucleotide (5’->3’GACTATCATATGCTTACCGT ...
-
bioRxiv - Plant Biology 2022Quote: ... Diagnostic PCR was performed using GoTaq G2 Flexi DNA polymerase according to a manufacturer’s protocol (Promega). Primers were designed using Primer3 0.4.0 software and synthesized by Sigma-Aldrich ...
-
bioRxiv - Cancer Biology 2023Quote: ... Then prepared cDNA was subjected to real-time PCR analysis with Eastep qPCR Master Mix (Promega) and primer mixtures (primer sequences are shown in table S2) ...
-
bioRxiv - Cell Biology 2023Quote: ... and served as the template for quantitative PCR (using GoTaq qPCR Master Mix, A6002, Promega, USA). Then ...
-
bioRxiv - Genetics 2023Quote: ... Genotyping PCRs were performed with GoTaq using the manufacturers recommendations (Promega, Catalogue No. M3008; Madison, USA). The annealing temperature was 58°C (30 seconds) ...
-
bioRxiv - Microbiology 2023Quote: ... 2μl of the lysate was subsequently used in a 20μL PCR reaction (Promega, Madison WI, USA) with forward primer 342F (5’-CTA CGG GGG GCA GCA G -3’ ...
-
bioRxiv - Microbiology 2023Quote: ... Quantitative real-time PCR was performed using the 2x GoTaq qPCR master mix (Promega, Walldorf, Germany) with 10 ng of cDNA template and 0.5 µM of each oligonucleotide in a final volume of 15 µL ...
-
bioRxiv - Microbiology 2023Quote: ... The fused PCR fragment was then cloned into the pGEM-T Easy vector (Promega, Madison, WI) generating flgE::kan ...
-
bioRxiv - Genomics 2023Quote: ... The single-stranded DNA generated using this method was purified using PCR purification kit (A9285; Promega) and quantified using Nanodrop ...
-
Zero-shot learning enables instant denoising and super-resolution in optical fluorescence microscopybioRxiv - Bioengineering 2023Quote: ... The monoclonal cells with successful EGFP incorporation were identified by PCR screening using GoTaq Polymerase (Promega). The clonal SUM159 cells expressing EGFP-Rab11A+/+ were subjected to the second round of genome editing to incorporate Lamp1-Halo in the genome as described above ...
-
bioRxiv - Biophysics 2023Quote: ... and extracted each from the gel using a standard protocol from PCR purification kit (Promega, A9282). We then mixed the three fragments together in 10 µl in molar ratio 1:2:1 ...
-
bioRxiv - Neuroscience 2023Quote: ... 1.25µl was used for the PCR reaction employing GoTaq G2 DNA Polymerase (M7845, Promega, Dübendorf, Switzerland) with primers (Microsynth ...
-
bioRxiv - Plant Biology 2023Quote: Coding regions of OSH15 and RI were PCR amplified and cloned into the pTnT vector (Promega). The FLAG and Myc tag were introduced into the N-termini of OSH15 and RI ...
-
bioRxiv - Plant Biology 2024Quote: ... The PeSPL6 and PeSPL13a 5’-ends were amplified by PCR using the GoTaq Master mix (Promega), the forward 5’ Primer from GeneRacer kit and the reverse Gene Specific Primer (GSP) ...
-
bioRxiv - Molecular Biology 2023Quote: ... and resulting PCR products were subcloned into a pGEM-T vector (Promega, pGEM-T Vector Systems) for subsequent Sanger sequencing of both alleles ...
-
bioRxiv - Molecular Biology 2023Quote: ... Both PCRs were performed by using the GoTaq® Master Mix DNA polymerase (Promega, Madison, WI), 10 ng of gDNA and in a 10 µl reaction volume ...
-
bioRxiv - Microbiology 2024Quote: ... ChIP eluates were purified with Wizard SV Gel and PCR clean-up system (Promega, Cat# A9282). Primer sequences are shown in Table S2 ...
-
bioRxiv - Molecular Biology 2023Quote: ... 1/20 of the cDNA was amplified by PCR using the GoTaq DNA polymerase mix (Promega) with specific antigenome primers (Appendix Table S1) ...
-
bioRxiv - Molecular Biology 2020Quote: ... PCR amplification was performed in 25 μl reactions using 5 μl X Green GoTaq Flexi Buffer (Promega), 1.5 μl MgCl2 (25mM ...
-
bioRxiv - Plant Biology 2022Quote: ... All nucleotide sequences were amplified by PCR from PXO99A genomic DNA and cloned into pGEM-T (Promega). These intermediate constructs were verified by sequencing ...
-
bioRxiv - Developmental Biology 2022Quote: ... and purified using a Nucleospin PCR clean-up kit and subcloned into p-GEM T-easy (Promega). Antisense RNA probes were synthesized using T3 ...
-
bioRxiv - Epidemiology 2019Quote: ... The PCRs were run in a total volume of 25uL containing GoTaq Green Master Mix (Promega M712), primers ...
-
bioRxiv - Molecular Biology 2019Quote: The PCR product was first cloned into the pGEM®-T Easy vector (Promega Co. Cat #A1360) to facilitate the sequencing process and subcloning into the pET28a (+ ...
-
bioRxiv - Molecular Biology 2020Quote: ... The DNA used for the different PCRs were purified by using the Wizard® Genomics Kit (Promega).
-
bioRxiv - Genomics 2021Quote: ... Four µL of purified A-tailed PCR products were ligated to pGEM-T easy vector (Promega Corporation) and 5 µL of this ligated mixture was then transformed into DH5α competent cells (New England Biolab ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... PCR products with low concentration or bad sequencing quality were cloned into pGEM-T Easy Vector (Promega) for sequencing ...
-
bioRxiv - Microbiology 2019Quote: ... the reaction products were purified using Wizard® PCR Preps DNA Purification System (Promega, Madison, WI, USA), and the concentration and purity of the products were evaluated by spectrophotometry (Eppendorf BioPhotometer ...
-
bioRxiv - Bioengineering 2021Quote: ... and digested vector was isolated using the Promega Wizard SV gel extraction and PCR cleanup kit (Promega). Products were then ligated overnight at 16°C following the NEB T4 DNA ligase protocol with 50 ng of pSLQ615 ...
-
bioRxiv - Plant Biology 2021Quote: Full-length LFY (AT5G61850.1, 420 residues) coding sequence was PCR amplified and cloned into pTnT vector (Promega) with an N-terminal 5XMyC tag to generate construct pTnT-5MyC-LFY.
-
bioRxiv - Plant Biology 2021Quote: ... High Resolution Melt (HRM) curves were performed with the GoTaq PCR MasterMix® (Promega, Madison, WI, USA) on a Rotor-Gene Q machine (Qiagen ...
-
bioRxiv - Microbiology 2021Quote: ... Standard methods were used throughout for PCR using GoTaq Flexi DNA polymerase according to manufacturer’s instructions (Promega), and fragment analysis was carried out as previously described (30) ...
-
bioRxiv - Plant Biology 2020Quote: ... Routine PCRs for cloning confirmation or plant genotyping were performed using Gotaq Flexi DNA Polymerase (Promega, USA) following instructions from the manufacturer ...
-
bioRxiv - Microbiology 2021Quote: ... The pooled samples were then concentrated using a Wizard SV Gel and PCR Clean-Up System (Promega). Quality control of the pooled and concentrated sample was done using an Agilent 2100 Bioanalyzer ...
-
bioRxiv - Cell Biology 2021Quote: ... The PCR products were first subcloned in pGEM®-T Easy vector (Promega, Charbonnieres les Bains, France) before being cloned into the XhoI/NcoI sites of the pET-15 vector (Novagen ...
-
bioRxiv - Cancer Biology 2022Quote: ... the PCR products were purified and cloned into the XbaI site of the pGL3-promoter vector (Promega) immediately downstream of the stop codon of luciferase ...
-
bioRxiv - Microbiology 2022Quote: ... and 1.25 units of GoTaq polymerase units in 50 μl final 1X PCR buffer (Promega, Madison, WI), and were run in a Robocycler (Stratagene ...
-
bioRxiv - Genomics 2022Quote: ... PCR products were purified once with a 3.0× Pronex size-selective purification system (Promega, Madison, WI, USA) and eluted with 22 μL of 10mM Tris-HCl pH8.0 ...
-
bioRxiv - Developmental Biology 2022Quote: The quantitative PCR (QPCR) reaction mix (20 μl) contained GoTaq qPCR Master Mix (10μl) (Promega, Madison, WI), forward and reverse primers (1.2 μl ...
-
bioRxiv - Microbiology 2021Quote: ... The PCR products were cloned using the pGEM®–T Easy Vector System (Promega, Madison, WI, USA), transformed by heat–shock into E ...
-
bioRxiv - Microbiology 2021Quote: ... Virus -specific PCR products were cloned into pGEM-T Easy Vector (A1360, Promega Co., Madison, WI, USA) and used to transform E ...
-
bioRxiv - Neuroscience 2021Quote: ... was purified using gel clean-up kit (Wizard® SV Gel and PCR Clean-Up, A9281, Promega) (Figure S4B) ...