Labshake search
Citations for Promega :
1651 - 1700 of 2354 citations for ssc mir 15a RT PCR Primer Set since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2023Quote: ... The PCR product was cloned using the pGEM®-T Easy vector (Promega, USA) before the sequencing ...
-
bioRxiv - Genetics 2023Quote: ... and amplified by PCR using the GoTaq Master Mix (Promega, Charbonnières les Bains, France). We employed specific primers for PTGER1 ...
-
bioRxiv - Developmental Biology 2023Quote: ... The PCR products were digested by direct addition of 0.5 µl of HindIII (Promega) and incubation for 1 h at 37 °C ...
-
bioRxiv - Microbiology 2024Quote: ... PCR products were quantified using the QuantiFluor™-ST Blue Fluorescence Quantification System (Promega). After Illumina PE250 library construction ...
-
bioRxiv - Molecular Biology 2023Quote: ... Libraries were amplified by 16 cycles of PCR with GoTaq Flexi DNA Polymerase (Promega), purified using Agencourt AMPure XP (Beckman Coulter ...
-
bioRxiv - Molecular Biology 2023Quote: ... Parental plasmids were selectively linearised from the PCR product via digestion with Dpnl (Promega) in lx MULTI-CORE buffer for 1hr at 37°C and the digestion product was immediately transformed into Stbl3 competent bacteria.
-
bioRxiv - Molecular Biology 2023Quote: ... The PCR-amplified products were then cloned into the pGEM-T Easy Vector (Promega) and subjected to sequencing for further analysis.
-
bioRxiv - Biophysics 2023Quote: ... a regular PCR was run on a thermocycler using Taq polymerase master mix (Promega). Gene knockout was thereby confirmed by gel electrophoresis ...
-
bioRxiv - Biochemistry 2023Quote: Quantitative PCR: Taq qPCR was performed using SYBR Green GoTaq qPCR master mix (Promega) according to manufacturer’s instructions on a LightCycler 96 SW 1.0 (Roche Diagnostics GmbH ...
-
bioRxiv - Microbiology 2023Quote: The amplified products underwent purification using Quick PCR purification columns (Promega, Madison, WI, USA) and were subsequently sequenced with the Big Dye Terminator Cycle Sequencing Ready Reaction Kit on an Applied Biosystems analyzer (Applied Biosystems ...
-
bioRxiv - Synthetic Biology 2023Quote: ... All the resulting amplicons were purified using the Wizard SV PCR cleanup system (Promega). The DNA fragment for the vector was amplified by PCR using the primer set Inv-pARP3-fwd/Inv-pARP3-rev and the pARP3 plasmid as the DNA template ...
-
bioRxiv - Molecular Biology 2024Quote: ... The resulting PCR product was then cloned in pGEMT-easy cloning vector (Promega, USA). Cloning and HvHsfA6a gene was confirmed by sequencing followed by BLAST search using NCBI ...
-
bioRxiv - Plant Biology 2024Quote: ... PCR products were purified for cloning into the pGEMT vector (Promega, Madison, WI, USA). A minimum of 10 clones per PCR product were sequenced to characterize the edited alleles in the transgenic plants.
-
bioRxiv - Neuroscience 2024Quote: ... genotyping PCR was performed using Go Taq Green Master Mix (Promega, Madison, WI, USA) with the following four primer sets ...
-
bioRxiv - Microbiology 2024Quote: ... Amplicons were subsequently gel-extracted (Wizard SV Gel and PCR Clean-Up System, Promega), quantified ...
-
bioRxiv - Plant Biology 2020Quote: ... PCR amplifications for genotyping were performed using GoTaq Green Master Mix (Promega, Madison, WI, USA), with the resulting products subjected to 3% agarose gel electrophoresis (Supplemental Fig ...
-
bioRxiv - Cell Biology 2020Quote: ... The PCR product was digested with XhoI and NcoI and ligated into pGL3-control (Promega). The resulting plasmid ...
-
bioRxiv - Cell Biology 2020Quote: ... The linear PCR products were circularised by ligation with T4 DNA ligase (Promega Cat#M180A) (O/N ...
-
bioRxiv - Cell Biology 2020Quote: ... All PCR reactions on cDNA were performed using the GoTaq DNA polymerase (Promega, Madison, WI) unless otherwise noted ...
-
bioRxiv - Cell Biology 2020Quote: ... This PCR reaction was carried out with GoTaq G2 hot start DNA Polymerase (Promega, F549L). All PCR reactions were in 96-well plates with a Freedom EVO 200 (Tecan ...
-
bioRxiv - Neuroscience 2021Quote: ... The reverse-transcribed cDNA was subjected to quantitative PCR using GoTaq qPCR Master Mix (Promega) and the StepOnePlus™ Real-time PCR system (Applied Biosystems ...
-
bioRxiv - Microbiology 2021Quote: ... Successful integration was confirmed by diagnostic PCR using GOtaq Hot Start Green Master Mix (Promega). For primer sequences see Supplementary file 1.
-
bioRxiv - Developmental Biology 2022Quote: ... or produced by PCR amplification of a fragment subsequently ligated in pGEMT Easy vector (Promega). Primers used to amplify the fragment of interest are listed in Table S2 ...
-
bioRxiv - Genomics 2019Quote: ... cDNA was amplified with the following protocol: 1X Promega PCR Master Mix (Promega, Fitchburg, WI), 2.5µL cDNA template ...
-
bioRxiv - Microbiology 2019Quote: ... PCR to confirm presence of transposon was preformed using GoTaq® Green Master Mix (Promega) and primers KanF (TGGATTGCACGCAGGTTCTC ...
-
bioRxiv - Cancer Biology 2019Quote: ... Real-time PCR reactions were carried out using 1x GoTaq™ qPCR Master Mix (Promega) and 0,25 μM of forward and reverse primers (Table S5 ...
-
bioRxiv - Molecular Biology 2019Quote: ... PCRs were performed using 7.5 ng of cDNAs with GoTaq polymerase (Promega, Madison, WI, USA). PCR products were separated by ethidium bromide-labeled agarose gel electrophoresis ...
-
bioRxiv - Genetics 2020Quote: ... The PCR products were cloned into pGEM®-T Easy vector (Promega, cat. no: A1360), and ten colonies were selected for sequencing.
-
bioRxiv - Cell Biology 2021Quote: ... were amplified by PCR and cloned into the pGL3-Basic luciferase reporter vector (Promega, E1751) using the KpnI and XhoI sites [promoter sequence defined using the Eukaryotic promoter database (https://epd.epfl.ch//index.php)] ...
-
bioRxiv - Microbiology 2020Quote: ... quantitative real-time PCR was carried out according to the GoTaq qPCR Master Mix (Promega) with 20 µl of a reaction mixture containing gene-specific primers (Supplementary Table 3) ...
-
bioRxiv - Genetics 2019Quote: ... The resulting PCR products were inserted by TA cloning into pGEM-T Easy plasmid (Promega) possessing T7 and SP6 promoters ...
-
bioRxiv - Neuroscience 2021Quote: ... PCR reaction (25 μl) contained 12.5 μl of Go-Taq Master Mixes (Promega, Milan, Italy), 1 µl (25 pmoles ...
-
bioRxiv - Neuroscience 2020Quote: ... PCR reactions were performed using 25ng bisulfite converted DNA using GoTaq® DNA Polymerase (Promega). The TA Cloning Kit (Invitrogen ...
-
bioRxiv - Cell Biology 2021Quote: Sequences for generating probes were amplified from cDNA by PCR using GoTaq DNA Polymerase (Promega) on a BioRad T100 Thermal cycler ...
-
bioRxiv - Plant Biology 2021Quote: ... Probes against siRNA populations were PCR products labelled with the Prime-a-Gene kit (Promega). Over-night hybridization at 42°C was in PerfectHyb buffer (Sigma ...
-
bioRxiv - Microbiology 2021Quote: ... pRRL.sin.cPPT.SFFV/Firefly-IRES-PuromycinR.WPRE was obtained by amplification of Firefly by PCR from pGL4 (Promega) and cloned into BamHI-XhoI-digested pRRL.sin.cPPT.SFFV/E2-crimson-IRES-PuromycinR.WPRE ...
-
bioRxiv - Physiology 2021Quote: ... PCR products were purified with the Wizard SV Genomic DNA Purification System (Promega, Cat# A2361), and sent in to a commercial sequencing platform (Eurofins Genomics ...
-
bioRxiv - Plant Biology 2020Quote: ... collected supernatant was used as a template in a standard PCR reaction using GoTaq (Promega) with Cas9-specific primers or primers to amplify the gRNA(s ...
-
bioRxiv - Microbiology 2020Quote: ... PCR was conducted with the following reaction conditions: 0.1 U/µL Gotaq (Promega, Madison, WI), 1X Gotaq buffer ...
-
bioRxiv - Cell Biology 2021Quote: ... The amplified product was purified using Wizard SV Gel and PCR Clean-up system (Promega) and inserted into T-Vector pMD20 (Takara Bio ...
-
bioRxiv - Microbiology 2022Quote: ... PCR-amplification of both nosZ genes used the Promega GoTaq qPCR kit (Promega, Madison, WI) and 1 μL of DNA template (25-50 ng genomic DNA ...
-
bioRxiv - Microbiology 2022Quote: ... Barcoded amplicons were purified by the Wizard SV Gel and PCR Clean-Up System (Promega) and quantified using the Qubit dsDNA HS assay ...
-
bioRxiv - Microbiology 2022Quote: ... PCR products were cloned into pGEM-T Easy and transformed into DH5α competent cells (Promega). Plasmid DNA was purified using the Qiagen midiprep kit (Qiagne ...
-
bioRxiv - Plant Biology 2021Quote: ... the supernatant was used as a template in a standard PCR reaction using GoTaq (Promega) with Cas9-specific primers (to select primary plant transformant (T0 ...
-
bioRxiv - Microbiology 2021Quote: ... Purified PCR products were cloned into pGEM®-T Easy Vector (Promega, Madison, WI, USA), and transformed into OneShot TOP10 chemically competent Escherichia coli cells (Invitrogen ...
-
bioRxiv - Developmental Biology 2020Quote: ... Equal amounts (according to PCR quantification) were used with the GoTaq qPCR Master Mix (Promega) in a 7300 real-time PCR system (ABI) ...
-
bioRxiv - Plant Biology 2021Quote: ... colony PCR screens were conducted using GoTaq® Green Master Mix (Promega, Madison WI, USA) with the following conditions ...
-
bioRxiv - Plant Biology 2021Quote: Full length Luciferase coding sequence was PCR amplified from the pGEM-luc cassette vector (Promega) using the primer pair ...
-
bioRxiv - Immunology 2020Quote: The murine Linc00402 probe template was generated by PCR (GoTaq Green 2X Master Mix, Promega) amplifying a 368 nt region from C57BL/6 T cell-derived DNA using the following forward and reverse primers containing EcoRI and HindIII sites ...
-
bioRxiv - Neuroscience 2021Quote: ... The PCR2 products were cleaned up and concentrated by SV wizard PCR cleanup kit (Promega), Ampure XP beads (Beckman Coulter) ...