Labshake search
Citations for Promega :
1801 - 1850 of 5335 citations for hsa mir 185 Real time RT PCR Detection Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Synthetic Biology 2021Quote: ... chromosomal isolation kit (Promega (USA)) ...
-
bioRxiv - Plant Biology 2020Quote: ... Oligo dT kit (Promega, USA) according to the manufacturers’ instructions ...
-
bioRxiv - Cell Biology 2020Quote: ... GoTaq®qPCR kit (Promega) was used for qPCR analysis ...
-
bioRxiv - Genomics 2021Quote: ... PureYield plasmid miniprep kits (Promega), or QIAprep Spin Miniprep kits ...
-
bioRxiv - Cell Biology 2022Quote: ... The MTT assay kit (Promega) was used according to manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: GoTaq DNA polymerase kits (Promega) were used for PCR reactions ...
-
bioRxiv - Genomics 2023Quote: ... the Tunnel staining kit (Promega) was used according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: ... sequencing reaction (fmol kit, Promega) using the same end labeled primer was run to identify the exact position of RT stops.
-
bioRxiv - Neuroscience 2023Quote: ... Oligo (dT) kit (Promega, #A2791) to reverse transcribe the RNA into cDNA following the manufacturer protocol.
-
bioRxiv - Microbiology 2023Quote: ... Reverse Transcription Kit (Promega, USA); IBV nucleic acid amplification fluorescence detection kit (Shanghai Furex Medical Scientific and Technological Development Co. ...
-
bioRxiv - Cancer Biology 2024Quote: ... Core Kit (Promega, Wisconsin, USA), following the manufacturer’s protocol ...
-
bioRxiv - Immunology 2021Quote: ... The plates were washed three times and the reaction was developed with 100 µL ready-to-use TMB solution (Promega, Madison, WI, USA) at RT for 20 min in the dark ...
-
bioRxiv - Molecular Biology 2022Quote: ... Then wells were washed again three times with PBS-T (100 μl per well) and incubated with a secondary mouse-HRP antibody (goat, Promega, Madison, WI, USA) (50 μl per well ...
-
bioRxiv - Molecular Biology 2022Quote: ... Subsequent to primary antibody removal chitin magnetic beads were washed three times with PBS-T and incubated with secondary mouse-HRP antibody (goat, Promega, Fitchburg, United States) 1:5000 in 100 μl sample buffer on a stirring wheel at room temperature for 1 h ...
-
bioRxiv - Biochemistry 2022Quote: ... the membrane was rinsed 10 min three times in PBS 1X-Tween buffer before ECL (Western Blotting Substrate, # W1001 Promega, Madison, WI, USA) revelation by image acquisition with the Fusion Fx chemiluminescence imaging system (Vilber Lourmat ...
-
bioRxiv - Plant Biology 2019Quote: ... The PCR amplification product was cloned into a pGEM®-T-Easy vector (Promega, Madison, Wisconsin) and named pHaHB4.2 ...
-
bioRxiv - Cancer Biology 2021Quote: ... which served as the template of quantitative PCR in the GoTaq® qPCR Master Mix (Promega). Then ...
-
bioRxiv - Cell Biology 2020Quote: ... PCR products were cloned into the pGEM-T Easy vector according to the manufacturer’s instructions (Promega) and sequenced using predesigned primers against the T7 promoter (MWG Eurofins).
-
bioRxiv - Microbiology 2021Quote: ... 1 µL cDNA was used as template for 25 cycles of PCR using GoTaq polymerase (Promega) targeting the TMV replicase using forward primer 5’ CCGCGAATCTTATGTGGAAT 3’ and reverse primer 5’ TCCTCCAAGTGTTCCCAATC 3’ ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... PCRs were performed with the GoTaq G2 Hot Start Green Master Mix (Promega, Madison, WI, USA) in an Applied Biosystems 2720 Thermal Cycler (Thermo Fisher Scientific ...
-
bioRxiv - Developmental Biology 2020Quote: ... The PCR reactions were performed using GoTaq®G2 Green Master Mix (Promega, WI, USA; #M7823) or Taq 2x Master Mix Kit (New England Biolabs® Inc. ...
-
bioRxiv - Molecular Biology 2020Quote: ... qRT-PCR products were amplified from HEK293T cDNA and inserted into the pGL3-Basic vector (Promega) using the overlap extension cloning method [4] ...
-
bioRxiv - Genomics 2020Quote: ... an amplicon containing a SNP was amplified by PCR from cDNA using GoTaq Flexi G2 (Promega) with 2.5 mM MgCl2 or Hot Star Taq (Qiagen ...
-
bioRxiv - Molecular Biology 2021Quote: Full-length human RNU6 sequence (110 nucleotides) was amplified by PCR and cloned into psiCHECK2 (Promega), downstream of Renilla luciferase ...
-
bioRxiv - Microbiology 2019Quote: ... Five brands of H2O PCR grade were tested: Nuclease-free water (Cat. No. P119C, Promega, USA); UltraPure™ DNase/RNase-Free distilled water (Cat ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... The band was excised and the Wizard® SV Gel and PCR Clean-up System (Promega) to extract and purify the DNA from the gel ...
-
bioRxiv - Genomics 2019Quote: The PCR products were excised from agarose gels and ligated into pGEM-T vector plasmids (Promega) with T4 DNA ligase (Promega) ...
-
bioRxiv - Genomics 2019Quote: ... PCR was performed according to the manufacturer’s recommendations (GoTaq DNA polymerase protocol, Promega, Madison, WI, USA). All PCR products were purified using the EPPIC Fast kit (A&A Biotechnology ...
-
bioRxiv - Molecular Biology 2019Quote: Amplified fragments were purified using a Wizard SV Gel and PCR Clean-Up System (Promega #A9281), diluted at a concentration of 1 µg/20 µl ...
-
bioRxiv - Genomics 2020Quote: The mid-transcript PCR product was ligated to pGEM®-T Easy vector (Promega Corporation, USA), following the manufacturer’s instructions and transformed into E ...
-
bioRxiv - Genetics 2021Quote: ... The purified DNA was PCR amplified using 2× GoTaq Colorless Master Mix (Promega, Madison, WI, USA), and PCR product was extracted as above to eliminate primer-dimers ...
-
bioRxiv - Developmental Biology 2020Quote: ... and the amplified PCR products were ligated into the pGEM-T easy vector (Promega Madison, WI) for DNA sequence verification ...
-
bioRxiv - Microbiology 2021Quote: ... The PCR reaction was conducted in a 50 μl contained Go Taq Colorless Master Mix (Promega), 20 μM Tn5-DPO primer ...
-
bioRxiv - Cell Biology 2021Quote: The upstream region of myogenin (−1650/+51) was PCR-amplified and clonedinto the pGL4.20 vector (Promega). The hnRNPK-expressing plasmid was a kind gift from Dr ...
-
bioRxiv - Biochemistry 2020Quote: ... Point mutations were introduced by PCR mutagenesis using the Pfu DNA polymerase (Promega, Alexandria, VIC, Australia). Cells were transfected using Lipofectamine® 3000 (Thermofisher Scientific ...
-
bioRxiv - Plant Biology 2020Quote: ... qRT-PCR was performed by using GoTaq® qPCR Master Mix (Promega Corporation, Madison, Wisconsin, EUA) accordingly to the manufacturer instructions ...
-
bioRxiv - Microbiology 2021Quote: ... PCR verifying experiments were performed with Go Taq Green Master Mix (Promega, Charbonnières les Bains, France), and PCRs requiring proofreading were performed with the Q5® High-Fidelity DNA Polymerase (New England BioLabs ...
-
bioRxiv - Molecular Biology 2020Quote: ... Obtained DNA was purified using the Wizard SV Gel and PCR Clean up system (Promega, US) in a final volume of 50 μL ...
-
bioRxiv - Cancer Biology 2020Quote: The region of interest (750-850 bp) was PCR amplified from pooled male human DNA (Promega) and cloned into a STARRseq luciferase validation vector_ORI_empty plasmid (Addgene plasmid #99298 ...
-
bioRxiv - Cell Biology 2021Quote: ... The digested plasmid was purified using the Wizard SV Gel and PCR Clean-up system (Promega). A guide sequence (TATTCGAGGCCATCGTGTACCGG ...
-
CRISPR screens for lipid regulators reveal a role for ER-bound SNX13 in lysosomal cholesterol exportbioRxiv - Cell Biology 2021Quote: ... qRT-PCR was performed using SYBRGreen-based technology GoTaq® qPCR master-mix (Promega, Cat# A600A). Specific SNX14 primers ...
-
bioRxiv - Neuroscience 2022Quote: ... 0.1 μL of passive reference (ROX) dye (GoTaq® Q-pcr Master Mix, cat# A6001, Promega), and 1.1 μL of nuclease-free H20 ...
-
bioRxiv - Cell Biology 2022Quote: ... The HaloTag-SmBiT fragment was PCR amplified from the commercially available plasmid (Promega, Cat no: N202A) and also subcloned into pcDNA3.1 ...
-
bioRxiv - Immunology 2021Quote: A semi-nested PCR was performed using a HotStart GoTaq Polymerase System (M500,1 Promega, Madison, WI). In addition to the forward and reverse primers used to amplify the paired TCRα:β templates ...
-
bioRxiv - Microbiology 2019Quote: ... BRYT GreenTM dye-based quantitative PCR (qPCR) was performed with the GoTaqTM qPCR Master Mix (Promega) and intron-spanning primer pairs (see Table S3 for a list of all primers) ...
-
bioRxiv - Cell Biology 2019Quote: ... The amplified PCR products were purified and cloned into pGEM-T Easy (Promega, Madison, WI, USA) and sequenced (1st Base ...
-
bioRxiv - Cell Biology 2019Quote: ... The amplified PCR products were purified and cloned into pGEM-T Easy (Promega, Madison, WI, USA) and sequenced (1st Base ...
-
bioRxiv - Microbiology 2021Quote: ... and primers using Wizard® SV Gel and PCR Clean-Up System (Promega, Madison, WI, USA). Cleaned amplified products were again run (5μl loaded ...
-
bioRxiv - Plant Biology 2021Quote: ... The qRT-PCR was performed in a reaction containing GoTaq® qPCR Master Mix (Promega, USA), cDNA ...
-
bioRxiv - Synthetic Biology 2021Quote: ... The Mobius Assemblies were verified first by colony PCR using GoTaq® Green Master Mix (Promega) and then with double restriction digestion with EcoRI-HF (NEB ...