Labshake search
Citations for Promega :
1851 - 1900 of 5335 citations for hsa mir 185 Real time RT PCR Detection Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Systems Biology 2021Quote: ... Both 1° and 2° assays were performed with 2x PCR master mix (Promega Corporation, Wisconsin, USA). The final PCR product from the 2° nested PCR was checked by electrophoresis in a 1.5% agarose gel ...
-
bioRxiv - Biophysics 2021Quote: ... Biotin-containing handles were made with a PCR on pBluescript SK+ (stratagene) with GoTaqG2 (Promega, M7845), in the presence of 1/5 biotin-16-dUTP (JenaBioscience ...
-
bioRxiv - Microbiology 2019Quote: ... or mCherry were amplified by PCR (5’-CCGGGTACCATGGGCAGCAGCCATCATC and 5’-CGGGAATTCTTACTTGTACAGCTCGTCCAT primers; Pfu DNA polymerase, Promega) from the pRGrectac-NHis constructions (Fernández-Tresguerres et al. ...
-
bioRxiv - Genomics 2021Quote: ... pSS-NLuc was created by PCR expansion of the target luciferase from pNL1.1 (Promega, Madison WI) into a vector containing the PCSK9 signal sequence from the same backbone (91) ...
-
bioRxiv - Genetics 2022Quote: ... the genomic DNA was used as a template for the PCR reactions using Go-Taq (Promega). The cycling consisted in initial denaturation ...
-
bioRxiv - Molecular Biology 2022Quote: ... End-point PCR to detect gene expression in mosquito tissues was performed using GoTaq polymerase (Promega) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2022Quote: ... the 16s rRNA gene region was PCR amplified with GoTaq Green Master Mix (Promega, Madison, WI), 16S rRNA gene primers 27F (AGAGTTTGATCMTGGCTCAG ...
-
bioRxiv - Microbiology 2022Quote: ... 1 μL of ligation product was amplified using PCR with a GO Taq DNA polymerase (Promega) and Illumina primers (P7 5’-CAAGCAGAAGACGGCATACGAGATAGACCGGGGACTTATCATCCAACCTGT-3’ ...
-
bioRxiv - Molecular Biology 2022Quote: ... This cDNA was also used for a conventional PCR using Go-Taq® Master Mix (Promega) with XBP1 splicing primers ...
-
bioRxiv - Microbiology 2022Quote: ... The resulting PCR product was cloned into the pGEM-T Easy vector system (Promega, WI, USA) and then digested with the restriction enzymes ...
-
bioRxiv - Molecular Biology 2022Quote: ... Colonies were screened by PCR screening using GoTaq G2 Hot Start green Master Mix (M7422, Promega) using the consensus pLKO F oligonucleotide (5’->3’GACTATCATATGCTTACCGT ...
-
bioRxiv - Plant Biology 2022Quote: ... Diagnostic PCR was performed using GoTaq G2 Flexi DNA polymerase according to a manufacturer’s protocol (Promega). Primers were designed using Primer3 0.4.0 software and synthesized by Sigma-Aldrich ...
-
bioRxiv - Genetics 2023Quote: ... Genotyping PCRs were performed with GoTaq using the manufacturers recommendations (Promega, Catalogue No. M3008; Madison, USA). The annealing temperature was 58°C (30 seconds) ...
-
bioRxiv - Cell Biology 2023Quote: ... and served as the template for quantitative PCR (using GoTaq qPCR Master Mix, A6002, Promega, USA). Then ...
-
bioRxiv - Microbiology 2023Quote: ... The fused PCR fragment was then cloned into the pGEM-T Easy vector (Promega, Madison, WI) generating flgE::kan ...
-
bioRxiv - Microbiology 2023Quote: ... 2μl of the lysate was subsequently used in a 20μL PCR reaction (Promega, Madison WI, USA) with forward primer 342F (5’-CTA CGG GGG GCA GCA G -3’ ...
-
Zero-shot learning enables instant denoising and super-resolution in optical fluorescence microscopybioRxiv - Bioengineering 2023Quote: ... The monoclonal cells with successful EGFP incorporation were identified by PCR screening using GoTaq Polymerase (Promega). The clonal SUM159 cells expressing EGFP-Rab11A+/+ were subjected to the second round of genome editing to incorporate Lamp1-Halo in the genome as described above ...
-
bioRxiv - Neuroscience 2023Quote: ... 1.25µl was used for the PCR reaction employing GoTaq G2 DNA Polymerase (M7845, Promega, Dübendorf, Switzerland) with primers (Microsynth ...
-
bioRxiv - Plant Biology 2023Quote: Coding regions of OSH15 and RI were PCR amplified and cloned into the pTnT vector (Promega). The FLAG and Myc tag were introduced into the N-termini of OSH15 and RI ...
-
bioRxiv - Molecular Biology 2023Quote: ... and resulting PCR products were subcloned into a pGEM-T vector (Promega, pGEM-T Vector Systems) for subsequent Sanger sequencing of both alleles ...
-
bioRxiv - Molecular Biology 2023Quote: ... Both PCRs were performed by using the GoTaq® Master Mix DNA polymerase (Promega, Madison, WI), 10 ng of gDNA and in a 10 µl reaction volume ...
-
bioRxiv - Plant Biology 2024Quote: ... The PeSPL6 and PeSPL13a 5’-ends were amplified by PCR using the GoTaq Master mix (Promega), the forward 5’ Primer from GeneRacer kit and the reverse Gene Specific Primer (GSP) ...
-
bioRxiv - Microbiology 2024Quote: ... ChIP eluates were purified with Wizard SV Gel and PCR clean-up system (Promega, Cat# A9282). Primer sequences are shown in Table S2 ...
-
bioRxiv - Plant Biology 2024Quote: ... PCR reactions (25 µL) were set up with GoTaq Green Master Mix (Promega, Madison, WI, USA), 200 nM of forward and reverse primers (Table S40) ...
-
bioRxiv - Molecular Biology 2023Quote: ... 1/20 of the cDNA was amplified by PCR using the GoTaq DNA polymerase mix (Promega) with specific antigenome primers (Appendix Table S1) ...
-
bioRxiv - Genomics 2023Quote: ... DNA was extracted using a commercial kit (Wizard Genomic DNA Purification Kit, Promega, Madison, WI). Libraries were produced by first fragmenting 75 ng DNA with the Nextera reagent (Illumina ...
-
bioRxiv - Zoology 2024Quote: DNA was extracted with several different kits including the Wizard Genomic DNA Purification kit (Promega) and the Qiagen Blood & Tissue kit ...
-
bioRxiv - Genomics 2021Quote: ... was extracted from tissue samples using a commercial kit (Wizard R Genomic DNA Purification Kit, Promega) following manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2020Quote: ... PCR amplification was performed in 25 μl reactions using 5 μl X Green GoTaq Flexi Buffer (Promega), 1.5 μl MgCl2 (25mM ...
-
bioRxiv - Plant Biology 2022Quote: ... All nucleotide sequences were amplified by PCR from PXO99A genomic DNA and cloned into pGEM-T (Promega). These intermediate constructs were verified by sequencing ...
-
bioRxiv - Molecular Biology 2021Quote: ... For PCR genotyping with primers listed in Supplementary Table S5 and the GoTaq G2 DNA Polymerase (Promega) according to manufacturer’s instructions ...
-
bioRxiv - Epidemiology 2019Quote: ... The PCRs were run in a total volume of 25uL containing GoTaq Green Master Mix (Promega M712), primers ...
-
bioRxiv - Molecular Biology 2019Quote: The PCR product was first cloned into the pGEM®-T Easy vector (Promega Co. Cat #A1360) to facilitate the sequencing process and subcloning into the pET28a (+ ...
-
bioRxiv - Genomics 2021Quote: ... Four µL of purified A-tailed PCR products were ligated to pGEM-T easy vector (Promega Corporation) and 5 µL of this ligated mixture was then transformed into DH5α competent cells (New England Biolab ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... PCR products with low concentration or bad sequencing quality were cloned into pGEM-T Easy Vector (Promega) for sequencing ...
-
bioRxiv - Microbiology 2019Quote: ... the reaction products were purified using Wizard® PCR Preps DNA Purification System (Promega, Madison, WI, USA), and the concentration and purity of the products were evaluated by spectrophotometry (Eppendorf BioPhotometer ...
-
bioRxiv - Plant Biology 2021Quote: Full-length LFY (AT5G61850.1, 420 residues) coding sequence was PCR amplified and cloned into pTnT vector (Promega) with an N-terminal 5XMyC tag to generate construct pTnT-5MyC-LFY.
-
bioRxiv - Plant Biology 2021Quote: ... High Resolution Melt (HRM) curves were performed with the GoTaq PCR MasterMix® (Promega, Madison, WI, USA) on a Rotor-Gene Q machine (Qiagen ...
-
bioRxiv - Microbiology 2021Quote: ... Standard methods were used throughout for PCR using GoTaq Flexi DNA polymerase according to manufacturer’s instructions (Promega), and fragment analysis was carried out as previously described (30) ...
-
bioRxiv - Plant Biology 2020Quote: ... Routine PCRs for cloning confirmation or plant genotyping were performed using Gotaq Flexi DNA Polymerase (Promega, USA) following instructions from the manufacturer ...
-
bioRxiv - Microbiology 2021Quote: ... The pooled samples were then concentrated using a Wizard SV Gel and PCR Clean-Up System (Promega). Quality control of the pooled and concentrated sample was done using an Agilent 2100 Bioanalyzer ...
-
bioRxiv - Cell Biology 2021Quote: ... The PCR products were first subcloned in pGEM®-T Easy vector (Promega, Charbonnieres les Bains, France) before being cloned into the XhoI/NcoI sites of the pET-15 vector (Novagen ...
-
bioRxiv - Cancer Biology 2022Quote: ... the PCR products were purified and cloned into the XbaI site of the pGL3-promoter vector (Promega) immediately downstream of the stop codon of luciferase ...
-
bioRxiv - Microbiology 2022Quote: ... and 1.25 units of GoTaq polymerase units in 50 μl final 1X PCR buffer (Promega, Madison, WI), and were run in a Robocycler (Stratagene ...
-
bioRxiv - Genomics 2022Quote: ... PCR products were purified once with a 3.0× Pronex size-selective purification system (Promega, Madison, WI, USA) and eluted with 22 μL of 10mM Tris-HCl pH8.0 ...
-
bioRxiv - Developmental Biology 2022Quote: The quantitative PCR (QPCR) reaction mix (20 μl) contained GoTaq qPCR Master Mix (10μl) (Promega, Madison, WI), forward and reverse primers (1.2 μl ...
-
bioRxiv - Microbiology 2021Quote: ... The PCR products were cloned using the pGEM®–T Easy Vector System (Promega, Madison, WI, USA), transformed by heat–shock into E ...
-
bioRxiv - Microbiology 2021Quote: ... Virus -specific PCR products were cloned into pGEM-T Easy Vector (A1360, Promega Co., Madison, WI, USA) and used to transform E ...
-
bioRxiv - Microbiology 2022Quote: ... clones were screened by colony PCR with sabBFor and jhp0660R primers and Go Taq master mix (Promega). Dye-terminator sequencing using BigDye (Thermo Fisher ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... 2006) in following conditions: 10 μl PCR mix included 0.5 volume GoTaq® Green Master Mix (Promega), 1 μl primer P1(10μM) ...