Labshake search
Citations for Promega :
1601 - 1650 of 5637 citations for hsa mir 185 Real time RT PCR Detection Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2019Quote: ... and gel extraction (Wizard™ SV Gel and PCR Cleanup System [Promega A9282]) following the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2020Quote: ... PCR products were cloned into the pGEM-T Easy vector (Promega, Cat. A1360) and submitted to Sanger sequencing.
-
bioRxiv - Developmental Biology 2022Quote: ... Quantitative PCR was performed using the GoTaq qPCR master mix 2x (Promega, #A6001) with a Bio-Rad CFX384 Real-Time thermal cycler ...
-
bioRxiv - Microbiology 2022Quote: Polymerase chain reaction was performed using the GoTaq PCR master mix (Promega, USA) as per manufacturer’s instructions ...
-
bioRxiv - Bioengineering 2022Quote: ... PCR product was purified and ligated to the pGEM®-T vector (Promega). The construction was transformed into NEB® Turbo competent E ...
-
bioRxiv - Biochemistry 2022Quote: ... PCR amplifications were carried out using the GoTaq Green Master Mix (Promega, Wisconsin) in a reaction volume of 12.5 µL with 5 µL of a 1:20 dilution of the DNA extract as a template ...
-
bioRxiv - Cancer Biology 2022Quote: ... PCR amplification was done using GoTaq G2 Green Master Mix (#M7823, Promega, USA).
-
bioRxiv - Developmental Biology 2022Quote: ... PCR products were cloned into the pGEM-T Easy vector (Promega, Madison, WI). Linearized template DNA (amplified from plasmid with T7/SP6 primers ...
-
bioRxiv - Cell Biology 2022Quote: ... β and γ DNA was next PCR amplified with the Q5 polymerase (Promega) according to manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2022Quote: Transfected parasites were analyzed by diagnostic PCR using GoTaq Green master mix (Promega) and the following conditions ...
-
bioRxiv - Immunology 2022Quote: ... A-tailing of purified PCR products was performed using GoTaq polymerase (Promega, UK) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2022Quote: ... The PCR products were cloned into the pGL3-Basic (Promega, Madison, WI, USA) vector using a ClonExpress Entry One Step Cloning Kit (Vazyme ...
-
bioRxiv - Neuroscience 2022Quote: ... 2 μl of isolated genomic DNA was used for the genotyping PCR (Promega) using respective protocols.
-
bioRxiv - Immunology 2022Quote: ... and purified with the Wizard SV Gel and PCR Clean-Up System (Promega) after DNA electrophoresis ...
-
bioRxiv - Plant Biology 2023Quote: ... and purified using Wizard® SV Gel and PCR Clean-Up System (Promega). Next ...
-
bioRxiv - Biochemistry 2024Quote: ... the PCR products of the Strep-Flag-tag and NLuc (Promega, cat # N1091) were inserted into the pHLmMBP-8 vector (Addgene ...
-
bioRxiv - Biochemistry 2024Quote: ... Untagged CDK2 expression plasmid was cloned by PCR with CDK2-NLuc plasmid (Promega) as the template ...
-
bioRxiv - Neuroscience 2024Quote: ... PCR was performed with a Gotaq G2 Hot Start Polymerase system (#M7405, Promega). Pyrosequencing was conducted on a Pyromark Q96 Sequencer using matching reagents (#97204 ...
-
bioRxiv - Neuroscience 2024Quote: ... PCR reactions were performed with GoTaq G2 Flexi DNA Polymerase (Promega, Cat. #M7801) or Herculase II Fusion DNA Polymerase (Agilent ...
-
Regulation of Diseases-Associated Microglia in the Optic Nerve by Lipoxin B4 and Ocular HypertensionbioRxiv - Molecular Biology 2024Quote: ... and Cd68 were quantified by using GoTaq PCR master mix (Promega, Madison, WI) in OneStep Plus qPCR (Applied Biosystems ...
-
bioRxiv - Plant Biology 2024Quote: ... The secondary PCR product was cloned in pGEMT-Easy vector (Promega Madison, USA), and Sequencing was performed using the nos promoter’s AP2 and 5’ junction (Eurofins Genomics India Pvt ...
-
bioRxiv - Cell Biology 2024Quote: ... PCR products were sub-cloned into the pGEM-T Easy vector (Promega, A1360) and sequenced ...
-
bioRxiv - Developmental Biology 2024Quote: ... PCR products were verified by sequencing cloned into the pGL3-Control vector (Promega) by Gibson Assembly ...
-
bioRxiv - Cell Biology 2024Quote: ... The genome-edited monoclonal cell populations were identified by PCR (GoTaq Polymerase, Promega) and then verified by western blot analysis and imaging.
-
bioRxiv - Evolutionary Biology 2024Quote: ... PCR was run for 30 cycles using GoTaq G2 Green master mix (Promega) and specific primers ...
-
bioRxiv - Neuroscience 2023Quote: The PCR fragment were ligated into a pGEM-T Easy Vector System (Promega), transformed into chemically competent cells and sequenced ...
-
bioRxiv - Microbiology 2023Quote: ... The presence of the plasmid was confirmed by colony PCR (GoTaq polymerase, Promega). For construction of ATCC17978Δhcp::aprR ...
-
bioRxiv - Microbiology 2023Quote: ... After purification with the Wizard SV Gel and PCR Clean-Up System (Promega), the template plasmid DNA was digested with DpnI and used in the transformation reaction.
-
bioRxiv - Bioengineering 2023Quote: ... The amplicon was purified Wizard SV Gel and PCR Clean-up System (Promega) and was used to produce preselected libraries ...
-
bioRxiv - Bioengineering 2023Quote: ... PCR was performed using either GoTaq G2 Green Master Mix (Cat#M782B, Promega) or Kapa Hifi Hotstart Ready Mix ...
-
bioRxiv - Biochemistry 2023Quote: ... was from American Radiolabeled Chemicals Inc. (St. Louis, MO, USA) and PCR reagents and restriction enzymes from Promega Corporation (Madison ...
-
bioRxiv - Cancer Biology 2022Quote: ... DNA (1 μL) was PCR amplified in a mastermix of GoTaq Green (Promega) containing specific primers at a final concentration of 0.5 pmol/μL using the cycling conditions ...
-
bioRxiv - Plant Biology 2023Quote: ... purified using Wizard® SV Gel and PCR Clean-Up System (Promega, USA), according to the protocol provided by the manufacturer ...
-
bioRxiv - Cell Biology 2023Quote: ... The PCR products were cloned in the pGEM T Easy vector system (Promega) according to the manufacturer’s instructions and sequenced (Eurofins Genomics and SourceBioscience) ...
-
bioRxiv - Pathology 2023Quote: ... we performed two overlapping PCR on the RCA products with GoTaq Flexi (Promega) according to the manufacturer’s protocol to amplify the complete genome of MSV using primers targeting MSV-G (PCR#1 ...
-
bioRxiv - Plant Biology 2023Quote: ... The PCR product was first cloned in the pGEM-T Easy vector (Promega) and sequenced ...
-
bioRxiv - Molecular Biology 2023Quote: QRT-PCR was performed using the GoTaq qPCR Master Mix (Promega, Cat# A6002) on a QuantStudio 5 Real-Time PCR System (Applied Biosystems) ...
-
bioRxiv - Genetics 2024Quote: ... Purified PCR products (deletion-bearing, second-step amplicon) and the pGL4.23 vector (Promega) were double digested with NheI-HF (New England Biolabs ...
-
bioRxiv - Molecular Biology 2024Quote: ... PCR products were sub cloned into the pGEM-T-Easy vector (Promega, A1360) using manufactures instructions ...
-
bioRxiv - Synthetic Biology 2024Quote: ... and GoTaq master mix for colony PCR and genotyping (Promega, Madison, WI, USA). Primers were purchased from IDT (Coralville ...
-
bioRxiv - Plant Biology 2024Quote: ... We performed the quantitative PCR using GoTaq qPCR Master Mix (Promega, WI, USA) at the annealing temperature of 58 °C on LightCycler480 instrument (Roche ...
-
bioRxiv - Bioengineering 2024Quote: ... and purified using the SV Gel and PCR Clean-Up System (Promega Corporation) and were sequenced at the Eurofins genomics.
-
bioRxiv - Biophysics 2024Quote: ... 2.5 kbp DNA handles were produced using PCR from λ-DNA (Promega, USA) with a primer carrying either a 5’ biotin or 5’ triple-digoxigenin modification for specific binding to the beads (primers listed in Table S3A ...
-
bioRxiv - Cancer Biology 2024Quote: ... and PCR product subcloning in the pGEM-T Easy Vector Systems (Promega #A1360) followed by sanger sequencing of pGEM-T positive bacterial colonies ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... Purified PCR products were ligated into the pGEM-T Easy Vector (Promega A1360) using 5 μl of 2X Rapid Ligation Buffer ...
-
bioRxiv - Immunology 2024Quote: ... qRT-PCR was performed in triplicate using SYBR Green Master Mix (Promega, US) according to the manufacturer’s instructions ...
-
bioRxiv - Synthetic Biology 2024Quote: ... Genotyping PCRs were set up using GoTaq master mix (Promega, Madison, WI, USA), making sure to gently stir the DNA extraction with the pipette tip before pipetting into the reaction.
-
bioRxiv - Microbiology 2024Quote: ... Integration of the construct was controlled by PCR using GoTaq DNA polymerase (Promega) with primers ML5936 and ML4310.
-
bioRxiv - Microbiology 2024Quote: ... Integration of the construct was controlled by PCR using GoTaq DNA polymerase (Promega) with primers ML6115 and ML4310 ...
-
bioRxiv - Genomics 2024Quote: ... Extracted DNA was used to template PCR reactions with GoTaq polymerase (Promega #M3001) to amplify ITS (primers emITS-1:TGGTAGAGAATGATGGCTGTTG and emITS-4:GCCTCTATGCCTAATTGCCTTT ...