Labshake search
Citations for Promega :
9551 - 9600 of 10000+ citations since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2023Quote: ... The full-length cDNA was ligated into the pGEM T-Easy vector (Promega) and sequenced using Sanger’s method to confirm the specificity of the product ...
-
bioRxiv - Molecular Biology 2023Quote: ... The amplified product was then cloned into the pGEM T-Easy Vector (Promega) and subjected to Sanger sequencing ...
-
bioRxiv - Microbiology 2023Quote: ... dsDNA system (Promega) and then stored at -20°C.
-
Sphingosine induction of the Pseudomonas aeruginosa hemolytic phospholipase C/sphingomyelinase, PlcHbioRxiv - Microbiology 2023Quote: We observed induction of the chromosomal plcH-nLuc-plcR reporter in nanoluciferase reporter assays using the Nano-Glo® Luciferase Assay kit (Promega). The assay was conducted as described by the manufacturer with some modifications reported here ...
-
bioRxiv - Microbiology 2023Quote: ... and the reaction was purified using Wizard SV Gel and PCR Clean-Up System (Promega). The linearized Donor was combined with the HCMV GW BAC in a Gateway reaction with LR Clonase II Plus enzyme (Thermo-Fisher ...
-
bioRxiv - Microbiology 2023Quote: ... and 10 μl of Bright-Glo Luciferase (Promega Cat. No. E2620) substrate added ...
-
bioRxiv - Microbiology 2023Quote: ... pH 8.5 and further digested with trypsin (MS grade, Promega) in a ratio of 1:100 for 20 h at 37°C ...
-
bioRxiv - Microbiology 2023Quote: ... Input gDNA or cDNA was added to the qPCR master mix containing 1X Colorless GoTaq® Flexi Buffer (Promega, USA), 4 mM magnesium chloride (Promega) ...
-
bioRxiv - Microbiology 2023Quote: ... Harvested lysates were measured for luciferase units following manufacturer’s instructions of the Luciferase Assay System (Promega, Madison, WI). To determine fold inhibition ...
-
bioRxiv - Microbiology 2023Quote: ... A 100 bp DNA ladder (Promega, Madison, WI, USA) was used to validate the expected sizes of the amplified PCR products [24] ...
-
bioRxiv - Microbiology 2023Quote: ... and then incubated with anti-rabbit horseradish peroxidase (HRP) conjugate antibodies (1:20000 dilution) (Promega, Madison, WI, USA) for two hours at room temperature ...
-
bioRxiv - Microbiology 2023Quote: ... A nested PCR for the detection of the FRT-scar present in RDV-50.stop MHV68 was performed using 200 ng of genomic DNA with GoTaq polymerase (Promega) using primers (dPCR_R1_for GGACCACGCTTTCCAGAGAA ...
-
bioRxiv - Microbiology 2023Quote: ... lacusprofundi 16S rRNA genes followed by cloning of amplified products into a pGEM-T easy vector (Promega), transformation of JM109 competent cells (Promega) ...
-
bioRxiv - Microbiology 2023Quote: ... 1 mg/mL Proteinase K (Promega Corporation, WI, USA) with 0.5% SDS in PBS at 40 °C overnight ...
-
bioRxiv - Microbiology 2023Quote: ... transformation of JM109 competent cells (Promega), and subsequent plasmid purification using a peqGOLD Plasmid Miniprep Kit ...
-
bioRxiv - Microbiology 2023Quote: ... The cells were lysed with 1X passive lysis buffer (Promega Cat. No. E1941) and 10 μl of cell lysate ...
-
bioRxiv - Microbiology 2023Quote: We used the Wizard® Genomic DNA Purification Kit (Promega, USA) to isolate bacterial genomic DNA from E ...
-
bioRxiv - Microbiology 2023Quote: ... After 3-minute incubation we added 30 µl of NanoGlo Luciferase substrate (Promega) per well and nano luciferase activity was measured by Centro XS3 LB 960 luminometer (Berthold Technologies).
-
bioRxiv - Microbiology 2023Quote: ... A PCR product matching the correct target size was gel purified and ligated into pGEM-T Easy (Promega) to yield plcl::Kn ...
-
bioRxiv - Microbiology 2023Quote: ... 4 mM magnesium chloride (Promega), 0.4 mM dNTPs (Thermo Fisher Scientific) ...
-
bioRxiv - Microbiology 2023Quote: ... 1 µg total RNA and 0.5 μg random primers (Promega) were used with the GoScript™ Reverse transcriptase (Promega ...
-
bioRxiv - Microbiology 2023Quote: ... Total RNAs were isolated from the pellet using the Maxwell® 16 LEV miRNA Tissue Kit (Promega) according to the manufacturer’s instructions and an extra TURBO DNase (Invitrogen ...
-
bioRxiv - Microbiology 2023Quote: ... A Kinase-Glo (Promega) assay kit for kinase activity was used to determine the activity of the purified PanK under different conditions 16.
-
bioRxiv - Microbiology 2023Quote: ... combined with 100 uL BacTiter-Glo Reagent (Promega BacTiter-Glo™ Microbial Cell Viability Assay) ...
-
bioRxiv - Microbiology 2023Quote: ... VSV-G agarose beads and bound proteins were then treated with 10 μL of 10 μg/μL sequence grade trypsin (Promega) for 16 h at 37℃ with mild shaking ...
-
bioRxiv - Microbiology 2023Quote: ... The reaction was stopped on ice before adding 75 μL of luciferase assay reagent (Promega) and recording of luminescence.
-
bioRxiv - Microbiology 2023Quote: ... 6 μL S30 premix without amino acids (Promega), plus water to a final reaction volume of 15 μL were incubated for 1 h at 37°C ...
-
bioRxiv - Microbiology 2023Quote: The glycosyltransferase activity of the CslA-GlxA complex was quantitatively measured by using the UDP-GloTM glycosyltransferase assay kit (Promega). This assay detects the content of free UDP ...
-
bioRxiv - Microbiology 2023Quote: ... 5 mM UDP-glucose (UDP-Glc, Promega), 20 mM MgCl2 and 30 mΜ cyclic-di-GMP (Sigma) ...
-
bioRxiv - Microbiology 2023Quote: RT-qPCR was performed using the GoTaq 1-Step RT-qPCR kit (Promega Cat. No. A6020) using nifH and 16S rRNA (reference gene ...
-
bioRxiv - Microbiology 2023Quote: ... Cells were collected and lysed in Passive Lysis Buffer (Promega, Madison, WI, USA). The luciferase activity was measured on a Lumistar Galaxy (BMG Labtechnologies ...
-
bioRxiv - Microbiology 2023Quote: The intracellular ATP content of bacteria suspended in mineral water was determined using the luciferase-based BacTiter-Glo Microbial Cell Viability Assay kit (Promega). As per the manufacturer instructions ...
-
bioRxiv - Microbiology 2023Quote: ... 0.5 U GoTaq G2 Flexi Polymerase (Promega), and 0.25x SYBR green (Sigma Aldrich) ...
-
bioRxiv - Neuroscience 2023Quote: ... RNA concentration was determined by Fluorometry using the QuantiFluor RNA System (Promega #E3310) and 50 ng of RNA was reverse transcribed for analysis of marker enrichment by quantitative PCR (see extended methods).
-
bioRxiv - Neuroscience 2023Quote: ... The pool was quantified by Fluorometry using the QuantiFluor ONE dsDNA System (Cat# E4871, Promega, Madison, WI, USA) before sequencing ...
-
bioRxiv - Neuroscience 2023Quote: ... with protease inhibitors (Halt, Promega) by trituration followed by a twenty minute incubation on ice with Benzonase ...
-
bioRxiv - Neuroscience 2023Quote: ... Endotoxin free plasmid for transfection was purified using PureYield column kits (Mini/Maxi, Promega). Plasmid DNA for direct use in electroporation of iPSCs was further concentrated by precipitation ...
-
bioRxiv - Molecular Biology 2023Quote: ... treated with RQ1 RNase-free DNase (Promega), reverse transcribed with Superscript II Reverse Transcriptase ...
-
bioRxiv - Molecular Biology 2023Quote: ... 28.5 μL Fugene HD (Promega) was added to 685 μL OptiMEM and mixed gently ...
-
bioRxiv - Molecular Biology 2023Quote: ... was used as template to synthesize cDNA with M-MLV reverse transcriptase (Promega, M1701). Each quantitative real-time PCR (qRT-PCR ...
-
bioRxiv - Molecular Biology 2023Quote: ... The luminescence was measured using a GloMax Navigator System (Promega).
-
bioRxiv - Molecular Biology 2023Quote: ... 0.01% Protease Max (Promega) and 1 mM CaCl2 ...
-
bioRxiv - Microbiology 2023Quote: ... The plate was read using Nano-Glo® Luciferase Assay System (Promega) in a luminometer (BioTek Synergy LX Multimode Reader ...
-
bioRxiv - Microbiology 2023Quote: The N protein of SARS-CoV-2 B.1 D614G variant (NYI67-20 strain) was cloned into Nano-Luc vector pNLF1-N [CMV/Hygro] (N terminus) (Cat. N1351, Promega) as a fusion protein ...
-
bioRxiv - Molecular Biology 2023Quote: ... A polyclonal goat anti-mouse conjugated to horseradish peroxidase (1:5,000; 1:10,000; or 1:20,000; Promega, W4021) was used as the secondary antibody ...
-
bioRxiv - Microbiology 2023Quote: Swabs designated for microbial culture were spun down using DNA IQ Spin Baskets (Promega, Madison, WI). A portion of each sample was serially diluted with 1X phosphate buffered saline and plated onto Tryptic Soy Agar (TSA ...
-
bioRxiv - Microbiology 2023Quote: ... Swabs were spun down using DNA IQ Spin Baskets (Promega, Madison, WI) and DNA was extracted ...
-
bioRxiv - Microbiology 2023Quote: ... and then incubated for another hour with an anti-Mouse IgG HRP-conjugate secondary antibody (Promega) (diluted 1:10 000 in PBST) ...
-
bioRxiv - Microbiology 2023Quote: ... and an anti-Rabbit IgG HRP-conjugated secondary antibody (Promega) (diluted 1:5000 in PBST ...
-
bioRxiv - Microbiology 2023Quote: ... The plasmid sequence was verified using a SupreDye v3.1 Cycle Sequencing Kit (M&S TechnoSystems, Osaka, Japan, Cat# 063001) with a Spectrum Compact CE System (Promega).