Labshake search
Citations for Promega :
751 - 800 of 1464 citations for 2x SYBR Green qPCR Master Mix since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2022Quote: ... using the Promega GoTaq BRYT Green® dye-based qPCR kit (Promega, WI, USA) with 200 nM concentration of the appropriate primers ...
-
bioRxiv - Microbiology 2023Quote: ... The amplified products were stained with a mix of 2X Blue/Orange Loading Dye (Promega, Madison, USA), loading buffer (1X ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... These regions were PCR-amplified with GO taq Colorless Master Mix by Promega using primers designed for regions conserved across the six mitogenomes assembled in this study (data in S1 Text) ...
-
bioRxiv - Synthetic Biology 2021Quote: ... A master mix containing 0.2 μl of Nano-Glo Luciferase Assay Substrate (Promega), 9.8 μl Nano-Glo Luciferase Assay Buffer ...
-
bioRxiv - Developmental Biology 2021Quote: ... PCR reactions were performed with GoTaq® Hot Start Master Mix (Promega, M5122) using 1 μl of the reverse transcription reaction as template in 20 μl reaction volume ...
-
bioRxiv - Microbiology 2022Quote: Polymerase chain reaction was performed using the GoTaq PCR master mix (Promega, USA) as per manufacturer’s instructions ...
-
bioRxiv - Bioengineering 2022Quote: ... Library sequencing preparation was performed using the GoTaq Master Mix from Promega (#M7433). D-(+)-Glucose was ordered from Sigma-Aldrich (#G8270) ...
-
Regulation of Diseases-Associated Microglia in the Optic Nerve by Lipoxin B4 and Ocular HypertensionbioRxiv - Molecular Biology 2024Quote: ... and Cd68 were quantified by using GoTaq PCR master mix (Promega, Madison, WI) in OneStep Plus qPCR (Applied Biosystems ...
-
bioRxiv - Cancer Biology 2024Quote: ... and qRT-PCR was performed using the GoTaq qRT-PCR master mix (Promega) with the ViiA7 Real Time PCR system (Applied Biosystems) ...
-
bioRxiv - Microbiology 2024Quote: ... Each 25 µL reaction contained 1x GoTaq Colourless Master Mix (Promega, United States) and 0.3 µM Primers (invA_1869F ...
-
bioRxiv - Microbiology 2019Quote: ... 1 μl (200 nM) of each primer and 10 μl of GoTaq® qPCR Mastermix 2X (Promega Corporation, USA). The amplification program consisted of ...
-
bioRxiv - Cell Biology 2022Quote: ... 2X (Promega) according to manufacturer’s instructions ...
-
bioRxiv - Genomics 2020Quote: ... 0.2 μL GoScript™ RT Mix for 1-Step RT-qPCR (Promega, Madison, WI), 0.75 μL primer/probe sets for either N1 ...
-
bioRxiv - Molecular Biology 2022Quote: ... SYBR Green I nucleic acid gel stain and Go Taq Hot Start Polymerase (Promega). qRT-PCRs were carried out in a QuantStudio 3 Real-Time PCR system (Thermo Fisher Scientific) ...
-
bioRxiv - Cell Biology 2019Quote: ... Genotyping of mice was performed by PCR reaction using GoTaq Green Mix (Promega) and 0.5 μM of each primer ...
-
bioRxiv - Neuroscience 2024Quote: ... using BRYT Green Dye contained in the GoTaq 1-Step RT-qPCR kit (Promega: A6020) in the CFX96 Touch Real-Time PCR Detection system (Bio-Rad) ...
-
bioRxiv - Plant Biology 2020Quote: ... cDNA was diluted 5 folds with distilled water and used in a reaction mix composed of 1x GoTaq qRT-PCR master mix (Promega, USA) and 10 nM primers for RT-qPCR ...
-
bioRxiv - Physiology 2020Quote: ... We used the resulting cDNA to perform quantitative PCR with GoTaq master mix (Promega), and analyzed data with the standard ΔΔCt method ...
-
bioRxiv - Genomics 2021Quote: ... PCR was performed according to standard procedures using GoTaq Colorless Master Mix (Promega, M7832) on sperm ...
-
bioRxiv - Genomics 2020Quote: ... PCR was performed according to standard procedures using GoTaq Colorless Master Mix (Promega, M7832) on sperm ...
-
bioRxiv - Biophysics 2023Quote: ... followed by polymerase chain reaction (PCR) with GoTaq® G2 Master Mix (M7822, Promega) on Biometra TRIO Touch Thermocycler (207072X ...
-
bioRxiv - Genetics 2023Quote: ... and amplified by PCR using the GoTaq Master Mix (Promega, Charbonnières les Bains, France). We employed specific primers for PTGER1 ...
-
bioRxiv - Biophysics 2023Quote: ... a regular PCR was run on a thermocycler using Taq polymerase master mix (Promega). Gene knockout was thereby confirmed by gel electrophoresis ...
-
bioRxiv - Pathology 2020Quote: 0.4 µL GoScriptTM RT Mix for 1-Step RT-qPCR (Promega, Cat # A6120 and A6121)
-
bioRxiv - Pathology 2020Quote: 0.2 µL GoScriptTM RT Mix for 1-Step RT-qPCR (Promega, Cat # A6120 and A6121)
-
bioRxiv - Cancer Biology 2020Quote: ... Quantification of mRNA was performed using the BRYT Green® Dye (GoTaq® qPCR, #A600A, Promega) in a real-time PCR analysis system (StepOnePlus ...
-
bioRxiv - Genomics 2019Quote: ... cDNA was amplified with the following protocol: 1X Promega PCR Master Mix (Promega, Fitchburg, WI), 2.5µL cDNA template ...
-
bioRxiv - Genetics 2019Quote: ... 25 µL reactions were constructed using 1x Go-Taq colorless hotstart master mix (#M5133, Promega), 1 ng of gDNA for both an individual predicted to have a particular L1Hs insertion or an individual predicted not to have the insertion ...
-
bioRxiv - Neuroscience 2021Quote: ... The temporal expression of genes was characterized RT-PCR using GoTaq Master Mix (M712C, Promega) and oligonucleotide sequences are listed at https://zebrafishproject.ucsf.edu ...
-
bioRxiv - Bioengineering 2021Quote: The open reading frame for human SOX17 was PCR amplified using GoTaq Master Mix (Promega) from the PB-TRE3G-SOX17 plasmid (Table S5) ...
-
bioRxiv - Developmental Biology 2019Quote: RT-PCR detection of Actn2 splicing variants was performed using GoTaq PCR master mix (Promega) and primers ...
-
bioRxiv - Genetics 2021Quote: ... The purified DNA was PCR amplified using GoTaq Colorless Master Mix (Promega, Madison, WI, USA), and the PCR product was extracted as above to eliminate primer-dimers ...
-
bioRxiv - Microbiology 2022Quote: ... and YFV_500_6_left/right) as previously described (22) using the GoTaq Probe Master Mix (Promega, USA). The amplicons were purified and sequenced with the ABI3130 platform (Applied Biosystems ...
-
bioRxiv - Genetics 2024Quote: ... in 2x SSCT (0.1% Tween-20 in 2x SSC (Promega, Cat# V4261)) for 5 min at RT ...
-
bioRxiv - Genetics 2021Quote: ... The purified DNA was PCR amplified using 2× GoTaq Colorless Master Mix (Promega, Madison, WI, USA), and PCR product was extracted as above to eliminate primer-dimers ...
-
bioRxiv - Microbiology 2021Quote: ... The PCR reaction was conducted in a 50 μl contained Go Taq Colorless Master Mix (Promega), 20 μM Tn5-DPO primer ...
-
bioRxiv - Neuroscience 2022Quote: ... 0.1 μL of passive reference (ROX) dye (GoTaq® Q-pcr Master Mix, cat# A6001, Promega), and 1.1 μL of nuclease-free H20 ...
-
bioRxiv - Genomics 2021Quote: ... The RT-PCR experiments were conducted using the GoTaq G2 Hot Start Master mix (Promega #M7422). The PCR primers were listed in the Supplementary Figure S5 ...
-
bioRxiv - Molecular Biology 2022Quote: ... This cDNA was also used for a conventional PCR using Go-Taq® Master Mix (Promega) with XBP1 splicing primers ...
-
bioRxiv - Immunology 2023Quote: ... Each reaction was run in duplicate and prepared with GoTaq master mix (Promega Corporation, Madison, WI) according to manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2023Quote: ... PCR amplification of exon 2 of the NR2F2 gene was performed using PCR Master Mix (Promega; primer pair is listed in Appendix Table S1) ...
-
bioRxiv - Plant Biology 2024Quote: ... The PeSPL6 and PeSPL13a 5’-ends were amplified by PCR using the GoTaq Master mix (Promega), the forward 5’ Primer from GeneRacer kit and the reverse Gene Specific Primer (GSP) ...
-
bioRxiv - Molecular Biology 2023Quote: ... Both PCRs were performed by using the GoTaq® Master Mix DNA polymerase (Promega, Madison, WI), 10 ng of gDNA and in a 10 µl reaction volume ...
-
bioRxiv - Neuroscience 2022Quote: ... and 2X GoTaq (Promega). Thermocycler parameters ...
-
bioRxiv - Physiology 2023Quote: ... primers at a final concentration of 300nM and 6µL of GoTaq® qPCR Mix (Promega, Madison, USA). qPCR conditions were the following ...
-
bioRxiv - Bioengineering 2020Quote: ... Homozygous lpat2-3 T-DNA insertional mutants were identified by PCR using Promega PCR Master Mix (Promega) and combinations of the gene specific and T-DNA left border primers pairs ...
-
bioRxiv - Developmental Biology 2021Quote: ... a 725bp segment of the Svep1 transcript (NM_153366.4; 746-11179) was PCR amplified (PCR Master Mix, Promega) with one pair of exon-exon boundary overlapping primers (5’ TGTGGTCCTCCAAGTCACGTA 3’ ...
-
bioRxiv - Microbiology 2022Quote: ... clones were screened by colony PCR with sabBFor and jhp0660R primers and Go Taq master mix (Promega). Dye-terminator sequencing using BigDye (Thermo Fisher ...
-
bioRxiv - Molecular Biology 2019Quote: The entire genome was amplified by PCR using GoTaq 2× Hot Start Colorless Master Mix (Promega, USA) using overlapping primer sets (Ali et al. ...
-
bioRxiv - Genomics 2020Quote: ... PCR amplification was performed in a 10- μL reaction mixture containing 5 μL of GoTaq Master Mix (Promega), 5 pmol FAM-labeled universal primer (5′ - FAM-gctacggactgacctcggac-3′) ...