Labshake search
Citations for Promega :
551 - 600 of 1564 citations for 2x SYBR Green qPCR Master Mix since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2022Quote: ... the 16s rRNA gene region was PCR amplified with GoTaq Green Master Mix (Promega, Madison, WI), 16S rRNA gene primers 27F (AGAGTTTGATCMTGGCTCAG ...
-
bioRxiv - Plant Biology 2024Quote: ... PCR reactions (25 µL) were set up with GoTaq Green Master Mix (Promega, Madison, WI, USA), 200 nM of forward and reverse primers (Table S40) ...
-
bioRxiv - Molecular Biology 2024Quote: ... Positive colonies were screened by PCR using GoTaq G2 Hot Start green Master Mix (#M7422, Promega) using the consensus pLKO F oligonucleotide (5’->3’GACTATCATATGCTTACCGT ...
-
bioRxiv - Immunology 2024Quote: ... and the region around the gRNA site was PCR amplified using GoTaq Green Master Mix (Promega) (primers in Table 2) ...
-
bioRxiv - Synthetic Biology 2024Quote: ... Successful DNA assembly was verified first by colony PCR using GoTaq® Green Master Mix (Promega) and then with double restriction digestion with EcoRI-HF (NEB ...
-
bioRxiv - Microbiology 2024Quote: ... transformant strains were confirmed by standard yeast colony PCR using GoTaq Green Master Mix (Promega, USA). The yeast strains used and generated in this work are listed in Table S1.
-
bioRxiv - Plant Biology 2024Quote: ... PCR amplification was performed in an 8 µl reaction mixture comprising GoTaq Green Master Mix (Promega), primers ...
-
bioRxiv - Genetics 2022Quote: ... using a 2x GoTaq G2 Green premix (Promega). 5 μl of the PCR products were used for restriction fragment length polymorphism assay with the appropriate enzymes ...
-
bioRxiv - Bioengineering 2021Quote: ... The results were calculated using the 2-△△CT method according to the GoTaq qPCR Master Mix (Promega) manufacturer’s specifications.
-
bioRxiv - Developmental Biology 2022Quote: ... The results were calculated using the 2-ΔΔCT method according to the GoTaq qPCR Master Mix (Promega) manufacturer’s specifications.
-
bioRxiv - Immunology 2020Quote: ... Bacterial groups in cecal samples were measured by real-time PCR using GoTaq qPCR Master Mix (Promega) on Applied Biosystem 7900HT Fast or StepOne Plus™ Real-Time PCR Systems ...
-
bioRxiv - Molecular Biology 2019Quote: ... PCR amplification was performed in 10 μL reactions comprising of 1X GoTaq® qPCR master mix (Promega), 1 μM of gene specific forward and reverse primers (sequences are provided in Supplementary Table 3 ...
-
bioRxiv - Genomics 2021Quote: ... Diluted cDNA (1:20) was used in a PCR reaction with the GoTaq qPCR Master Mix (Promega) and run on a CFX384 Touch instrument (Bio-Rad).
-
bioRxiv - Bioengineering 2021Quote: ... The results were calculated using the 2-△△CT method according to the GoTaq qPCR Master Mix (Promega) manufacturer’s specifications.
-
bioRxiv - Cell Biology 2021Quote: The qRT-PCR reaction was carried out with GoTaq®qPCR Master Mix (Promega, Madison, WI, USA) on a CFX96 instrument (Bio-Rad ...
-
bioRxiv - Cancer Biology 2023Quote: ... Then the eluted DNA was subjected to real-time PCR analysis with Eastep qPCR Master Mix (Promega) and promoter-specific primer mixtures ...
-
bioRxiv - Genetics 2022Quote: Quantitative PCR was performed on the Roche LightCycler 96 instrument by using GoTaq qPCR Master Mix (Promega) with 1µl cDNA template and 0.5µl of 10mM each primer in a total volume of 25µl reaction ...
-
bioRxiv - Physiology 2023Quote: ... Each 10 µl PCR reaction consisted of 5 µl of GoTaq® qPCR Master Mix (Promega Corporation), 0.5 µl of 10 µM forward primer ...
-
bioRxiv - Immunology 2024Quote: ... Quantitative real-time PCR assays were carried out by using GoTaq® qPCR master mix (Promega, Germany) and QuantStudio™ 5 (Thermo fisher scientific ...
-
bioRxiv - Cancer Biology 2024Quote: ... Real-time quantitative PCR was performed for murine Clec18a and Gapdh with GoTaq qPCR master mix (Promega) on the CFX384 system (Bio-Rad) ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... and GoTaq qPCR mix (Promega). Expression levels were calculated relative to the normalisation genes Afr-myosin or Afr-tubulin ...
-
bioRxiv - Molecular Biology 2022Quote: ... using GoTaq qPCR Mix (Promega), according to the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2019Quote: ... qPCR amplifications (12 μl) were done in duplicates using 1 μl of cDNA and the GoTaq Probe 2X Master Mix (Promega) on a LightCycler 480 (Roche) ...
-
bioRxiv - Microbiology 2023Quote: ... The PCR reaction was performed in 25 μL final volumes and consisted of 12.5 μL GoTaq® G2 Hot Start Colorless Master Mix (2X - Promega), 1 μL of each primer (10 μM) ...
-
bioRxiv - Plant Biology 2023Quote: ... PCR reactions were conducted in 10 μL volume comprising 5 μL Promega 2x PCR Master Mix (Promega, Madison, Wisconsin, USA), 10 pmol of forward and reverse primers ...
-
bioRxiv - Developmental Biology 2021Quote: ... or Gotaq Master Mix (Promega) and then subjected to 2% agarose gel electrophoresis ...
-
bioRxiv - Plant Biology 2022Quote: ... 1X GoTaq Master Mix (Promega), and 500nM each of forward and reverse primers ...
-
bioRxiv - Genetics 2021Quote: ... GoTaq® Master Mix (PROMEGA) 1X and 0.2 µM of each primer ...
-
bioRxiv - Molecular Biology 2020Quote: ... using GoTaq Master Mix (Promega) with the gene specific primers (Table 1).
-
bioRxiv - Immunology 2024Quote: ... 1X Gotaq master mix (Promega), and 18 μL of the extracted sample in a final volume of 60 μL ...
-
bioRxiv - Genetics 2022Quote: ... 10 μl 2x GoTaq® Master Mixes (Promega, M7123), and 6 μl water ...
-
bioRxiv - Microbiology 2023Quote: ... 10 µL 2X master mixture (Promega, Madison, WI, USA), 1 µL forward and reverse primers (for each ...
-
bioRxiv - Epidemiology 2019Quote: ... The PCRs were run in a total volume of 25uL containing GoTaq Green Master Mix (Promega M712), primers ...
-
bioRxiv - Plant Biology 2021Quote: ... RT-PCR was performed with the GoTaq® Green Master Mix as per manufacturer’s instructions (Promega, USA). For RIP analysis ...
-
bioRxiv - Genomics 2019Quote: ... 1uL of genomic DNA was added to 12.5 μL of GoTaq Green Master Mix (Promega, Madison, WI) and 1 μL of each 10 μM primer using a 25 μL final PCR reaction volume ...
-
bioRxiv - Microbiology 2022Quote: ... 25 ng of DNA were mixed with 12.5 ul of Go-Taq green master mix enzyme (Promega) and 10 uM of each primer (supplementary table 1) ...
-
bioRxiv - Genetics 2024Quote: ... then a 5 min final extension (72 °C)—was carried out with GoTaq Green Master Mix (Promega). Deletion loci from mutant flies were amplified using the genotyping primers above with four GoTaq Green PCR reactions per line ...
-
bioRxiv - Cell Biology 2023Quote: ... Genotyping to identify bPAC and Drer_Chr1 (DNA extraction control) were performed using GoTaq Green master mix (Promega). DNA samples for genotyping were extracted (lysis buffer ...
-
bioRxiv - Immunology 2024Quote: ... PCR was done on gDNA from at least 6 individual larvae using GoTaq Green Master Mix (Promega) (Supp Fig 1A ...
-
bioRxiv - Molecular Biology 2024Quote: ... an initial PCR was performed using gDNA (100 ng) with 1x GoTaq Green Master Mix (Promega #M7123), and 0.5 μM of each primer ...
-
bioRxiv - Microbiology 2019Quote: ... Quantitative real-time polymerase chain reaction (PCR) was performed for CGRP with GoTaq® qPCR Master Mix (Promega) using the DNA-binding dye ...
-
bioRxiv - Genomics 2019Quote: ... We then set up quantitative PCR reactions with 5 µL GoTaq qPCR Master Mix (Promega, Madison, WI, USA), 1 µL each forward and reverse primer at 5 µM ...
-
bioRxiv - Immunology 2022Quote: ... MCMV-DNA was quantified by real-time PCR using BIO-RAD CFX with GoTaq qPCR Master Mix (Promega) and primers specific for MCMV glycoprotein B (gB ...
-
Mitochondrial Apolipoprotein MIC26 is a metabolic rheostat regulating central cellular fuel pathwaysbioRxiv - Cell Biology 2023Quote: ... quantitative real-time PCR was performed in Rotor Gene 6000 (Corbett Research) using GoTagR qPCR Master Mix (Promega) according to manufacturer’s instructions with the following primers:
-
bioRxiv - Plant Biology 2023Quote: ... The qPCR was done by using GoTaq qPCR mix (Promega) and performed on CFX96 Real-Time PCR Detection System (Bio-Rad) ...
-
bioRxiv - Molecular Biology 2024Quote: ... qPCR amplification was carried out with GoTaq qPCR mix (Promega) in a BioRad CFX-384 thermocycler using a 1/200 dilution of corresponding cDNAs ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... All PCR reactions were performed at 25µl total with 12.5 ul 2X Promega Hot Start Master Mix (Promega Corporation, Madison, USA) and the primer conditions listed in Tab 1 ...
-
bioRxiv - Microbiology 2023Quote: Insertion sites in individual clones were mapped using a two-step nested arbitrary PCR approach using 2X GoTaq master mix (Promega M7122). The first reaction (1X GoTaq master mix ...
-
bioRxiv - Developmental Biology 2021Quote: ... and SYBR Green fluorescent dye (Promega) were used ...
-
bioRxiv - Microbiology 2020Quote: ... 7.5 μL of SYBR Green (Promega), 0.5 μL of each primer (10 μM ...