Labshake search
Citations for Promega :
601 - 650 of 1464 citations for 2x SYBR Green qPCR Master Mix since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Synthetic Biology 2022Quote: ... The presence and orientation of DNA fragments were confirmed by colony PCR using GoTaq Green Master Mix (Promega, USA), whereas the sequence of the genetic construct was checked by Sanger sequencing reactions (Macrogen Inc. ...
-
bioRxiv - Neuroscience 2023Quote: Adult worms were lysed following standard protocols and PCRs were performed using GoTaq Green Master Mix (Promega, REF-M7123). Mutant alleles were distinguished from wild-type by imaging Restriction Fragment Length Polymorphisms (RFLP ...
-
bioRxiv - Plant Biology 2023Quote: ... gRNA-targeted regions were amplified from genomic DNA isolated from the T1 plants with GoTaq Green Master Mix (Promega) using the primers g1-seqF/g1-seqR and g2-seqF/g2-seqR for gRNA1 and gRNA2 ...
-
bioRxiv - Neuroscience 2023Quote: ... For all animals universal PCR reaction was used as follows: 12.5 μl of GoTaq Hot Start Green Master Mix (Promega), 0.5 μl of each primer (25 μM ...
-
bioRxiv - Immunology 2021Quote: ... RT-qPCR to detect ZIKV was performed in a 20 μL reaction final volume containing GoTaq one-step RT-qPCR master mix (Promega), 25 ng of sample RNA ...
-
bioRxiv - Molecular Biology 2020Quote: ... and real-time polymerase chain reaction (RT-PCR) conducted using the Techne Prime Pro thermal cycler with GoTaq qPCR Master Mix (Promega). RT-qPCR reactions were carried out in 10 μL volumes containing 3.5 mM MgCl2 ...
-
bioRxiv - Molecular Biology 2021Quote: One-sixth of the SNS preparation (from above) was used for qPCR assays which were performed with the Promega GoTaq master mix (Promega). Each qPCR reaction was carried out in triplicate and in all cases two independent biological replicates per condition were assayed per run ...
-
bioRxiv - Physiology 2019Quote: Relative expression levels of Fgf23 were determined by qRT-PCR using 2 μl synthesized cDNA and the GoTaq qPCR Master Mix (Promega) on a Rotor-Gene Q (Qiagen ...
-
bioRxiv - Cancer Biology 2020Quote: ... Quantitative PCR assays were performed using 1 ng of cDNA as template and the reactions were conducted using the GoTaq qPCR Master Mix (Promega). Real-time RT-PCR was performed on a MasterCycler Ep-Realplex thermal cycler (Eppendorf ...
-
bioRxiv - Developmental Biology 2019Quote: ... cells into micro-tubes containing 5 µl of cold 1X SuperScript IV VILO Master Mix for two-step RT-qPCR containing 6 units RNasin (Promega) and 0.5% (v/v ...
-
bioRxiv - Microbiology 2022Quote: ... Amplification was performed in 20 μl reaction volumes with 40 ng template cDNA using GoTaq® qPCR master mix (Promega) according to the manufacturer’s instructions ...
-
bioRxiv - Physiology 2022Quote: ... cDNA was synthesized by using qScript cDNA Synthesis Kit (QuantaBio, Beverly, MA) and PCR was performed with GoTaq qPCR Master Mix (Promega) with HPRT as the control gene ...
-
bioRxiv - Plant Biology 2022Quote: ... Quantitative reverse transcription PCR (qRT-PCR) was performed according to the method of Ehira and Miyazaki43 using Go Taq qPCR Master Mix (Promega). Primers used for PCR and qRT-PCR are listed in Supplementary Table 5.
-
bioRxiv - Molecular Biology 2023Quote: ... were used in qRT-PCR reactions to determine the relative mRNA levels of Tc_wap genes using GoTaq® qPCR Master Mix (Promega) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2023Quote: ... China and listed in Table S2) were incubated with 201tμL of the real-time PCR reaction mixture including GoTaq qPCR Master Mix (Promega, USA) at 95°C for 3 min ...
-
bioRxiv - Microbiology 2023Quote: ... Input gDNA or cDNA was added to the qPCR master mix containing 1X Colorless GoTaq® Flexi Buffer (Promega, USA), 4 mM magnesium chloride (Promega) ...
-
bioRxiv - Microbiology 2023Quote: ... core and modified histones and transcription factors at the HIV-1 LTR was assessed by quantitative PCR using primers spanning the full promoter (Table 1) with GoTaq qPCR Master mix kit (Promega) in a CFX Connect Real-Time PCR thermocycler (BioRad) ...
-
bioRxiv - Plant Biology 2021Quote: ... with GoTaq qPCR mix (Promega, Madison, USA). The primers designed in this study were listed in Table ...
-
bioRxiv - Genomics 2020Quote: ... or PCR master mix (Promega, Wisconsin, USA). For ExTaq polymerase reactions ...
-
bioRxiv - Genomics 2023Quote: ... 1X GoTaq® Colorless Master Mix (Promega), and 40 ng of DNA ...
-
bioRxiv - Plant Biology 2020Quote: ... PCRs were used to assay for wild-type or T-DNA insertion alleles in 20 μL reactions using GoTaq Green Master Mix (Promega) using manufacturer’s instructions and 30 cycles as follows ...
-
bioRxiv - Genetics 2021Quote: ... a 599 bp long construct was PCR amplified from genomic DNA isolated from the tail of a Pahenu2 homozygous animal using GoTaq G2 HotStart Green Master Mix (Promega). Primers are listed in Suppl ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... Cytochrome B was amplified from the same saliva sample in which DrDV-B was detected using primers Bat 05A and Bat 04A (45) and GoTaq Green Master Mix (Promega) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2022Quote: ... The amplification was performed in 25 μl mixtures containing 12.5 μl GoTaq□Green Master Mix (Promega, Madison, Wl, United States), 0.625 μl of each primer (20mM) ...
-
bioRxiv - Microbiology 2022Quote: ... The amplification was performed in 50 μl mixtures containing 20 μl GoTaq□Green Master Mix (Promega, Madison, Wl, United States), 1 μl of each primer (20 mM) ...
-
bioRxiv - Molecular Biology 2021Quote: A conventional PCR targeting the hsp65 gene was conducted using the GoTaq® Green Master Mix (Promega, Madison, Wisconsin, USA) in a final reaction volume of 13μl comprising 6.25μl of 2X GoTaq Hot Start Green Master Mix ...
-
bioRxiv - Bioengineering 2020Quote: ... The second round of PCR was run with 10μL GoTaq Green Master Mix (Promega Biosciences LLC, San Luis Obispo, CA), 4.2μL of water ...
-
bioRxiv - Neuroscience 2021Quote: Genomic DNA was extracted using HotSHOT (hot sodium hydroxide and tris) and PCR was performed using GoTaq green master mix (Promega) (Truett et al ...
-
bioRxiv - Bioengineering 2020Quote: ... The second round of PCR was run with 10μL GoTAQ Green Master Mix (Promega Biosciences LLC, San Luis Obispo, CA), 4.2μL of water ...
-
bioRxiv - Cancer Biology 2022Quote: ... a gene-specific amplicon was generated in a 20 μL reaction for 35 cycles with GoTaq G2 Green Master Mix (Promega). The PCR product was purified using the NucleoSpin Gel and PCR Clean-up kit (Macherey-Nagel) ...
-
bioRxiv - Physiology 2019Quote: The expression profile of PKC isoforms in UMR106 cells was studied by RT-PCR using the GoTaq Green Master Mix (Promega) and the primers listed in Table 1 ...
-
bioRxiv - Genetics 2020Quote: PCR used to detect the viral cDNA was performed using the GoTaq® Green Master Mix (Promega, Madison, WI, USA) under the following conditions ...
-
bioRxiv - Molecular Biology 2021Quote: ... PAT-PCR was performed using a 3’ UTR-specific forward primer and a y300 PAT universal C10 primer with GoTaq Green Master Mix (Promega). The primer sequences are provided in Table S1 ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... PCR was performed in a 25 µl reaction volume with 12.5 µl of GoTaq ® Green Master Mix (Promega, USA), 1 µl of 100 ng/µl gDNA ...
-
bioRxiv - Zoology 2021Quote: ... Polymerase chain reactions in a 15 μL solution containing 7.5 μL GoTaq® G2 Hot Start Green Master Mix (Promega), 0.4 μmol of each primer and 46 – 247 ng of genomic DNA were performed using a C1000 Touch Thermal Cylinder (BioRad) ...
-
bioRxiv - Plant Biology 2021Quote: ... The DNA pellet was resuspended in water with RNase A (10 µg/mL) for amplicon library preparation using GoTaq G2 Green Master Mix (Promega) and primers (Supplemental Table S1 ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... Each reaction was carried out in 15 μl volume containing 7.5 μl of GoTaq® Hot Start Green Master Mix (Promega), 0.5 μl each of the forward and reverse primer ...
-
bioRxiv - Cancer Biology 2022Quote: ... Pups were screened for the deletion by classical genotyping PCR with the GoTaq R2 Hot Start Green Master Mix (Promega) with fw (5’-CCTCGGAAGCTGCCTAAGAT-3’) ...
-
bioRxiv - Neuroscience 2023Quote: ... We performed targeted PCR by adding 1 μL of cell lysate (1:5 dilution) to a 25-μL PCR reaction containing GoTaq Hot Start Master Mix Green (Promega) and 0.5 μL of the primers (10 µM ...
-
bioRxiv - Plant Biology 2023Quote: ... Approximately 20 ng of trichome DNA was amplified by combining 0.25 μM primer and 1X GoTaq Green Master Mix (Promega, USA) in a 50μl reaction volume ...
-
bioRxiv - Bioengineering 2023Quote: ... Presumptive screening of 10 colonies per mPilA variant was performed via colony-PCR using GoTaq® Green Master Mix (Promega) and forward and reverse primers Diag:71301:MPilA:All:FWD and Diag:71301:MPilA:All:REV (SI Table S1) ...
-
bioRxiv - Cell Biology 2023Quote: ... Presence of rat cells in myoblast culture/muscle lysate was assessed by PCR for rat dystrophin using primers Rat Dmd i22-i23.F/ Rat Dmd i22-i23.R and GoTaq G2 Hot Start Green Master Mix (M7423, Promega) via the following program ...
-
bioRxiv - Molecular Biology 2024Quote: ... PAT-PCR was performed using a 3′ UTR-specific forward primer and a PAT universal primer with GoTaq Green Master Mix (Promega). The PCR products were separated by 6% PAGE in 0.5× TBE ...
-
bioRxiv - Molecular Biology 2023Quote: ... and target sites from the TRIP library were amplified by GoTaq G2 Hot Start Green Master Mix (Promega, 26 cycles). Amplicons were purified via gel extraction using a NucleoSpin Gel and PCR Clean-up Mini kit (Macherey-Nagel) ...
-
bioRxiv - Cancer Biology 2024Quote: ... DNA was extracted from lymphoma derived cell lines as described above and PCR amplified using sgRNA specific primers (Supplementary Table 3, p53 primers as previously described (13) and GoTaq Green Master Mix (Promega). PCR products were amplified a second time using indexing primers ...
-
bioRxiv - Cancer Biology 2024Quote: ... Integrated sgRNAs in each lymphoma sample were amplified from 100 ng of genomic DNA using GoTaq Green Master Mix (Promega) and indexing primers with unique overhangs (12) ...
-
bioRxiv - Developmental Biology 2024Quote: ... Digoxigenin-labelled or Fluorescein-labelled mRNA probes were either prepared as PCR probes with primers listed in Table S4 using the Kit GoTaq green master mix (Promega) or as described (Orgeur et al. ...
-
bioRxiv - Bioengineering 2021Quote: ... Primer concentrations for RT-qPCR reactions were initially evaluated by performing 25μL PCR reactions using Go Taq® Master Mix (Promega Corporation) with approximately 100μg of gDNA ...
-
bioRxiv - Systems Biology 2020Quote: ... and 1.2 μl of the diluted cDNA was added as template to a final volume of 25 μl including 1x GoTaq qPCR Master Mix according to the manufacturer’s instructions (Promega, Mannheim, Germany). qRT-PCR was performed using the ViiA7 real-time PCR system (Applied Biosystems) ...
-
bioRxiv - Cancer Biology 2020Quote: ... and housekeeping gene HPRT1 (FP: 5’ ATGACCAGTCAACAGGGGACAT 3’, RP: 5’ CAACACTTCGTGGGGTCCTTTTCA 3’) were measured using GoTaq qPCR Master Mix (Promega, A6001) on a TaqMan Viia 7 Real-Time PCR System ...