Labshake search
Citations for Promega :
501 - 550 of 1464 citations for 2x SYBR Green qPCR Master Mix since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2024Quote: ... Kanamycin-sensitive exconjugants were screened for the mutant with colony PCR using altgenoF and altgenoR primers designed outside of the deletion flanks with the following PCR reaction mix: 10 µl of GoTaq Green master mix (Promega), 0.5 µl of each primer at 10 µM concentration ...
-
bioRxiv - Cancer Biology 2021Quote: ... which served as the template of quantitative PCR in the GoTaq® qPCR Master Mix (Promega). Then ...
-
bioRxiv - Plant Biology 2020Quote: ... qRT-PCR was performed by using GoTaq® qPCR Master Mix (Promega Corporation, Madison, Wisconsin, EUA) accordingly to the manufacturer instructions ...
-
CRISPR screens for lipid regulators reveal a role for ER-bound SNX13 in lysosomal cholesterol exportbioRxiv - Cell Biology 2021Quote: ... qRT-PCR was performed using SYBRGreen-based technology GoTaq® qPCR master-mix (Promega, Cat# A600A). Specific SNX14 primers ...
-
bioRxiv - Plant Biology 2021Quote: ... The qRT-PCR was performed in a reaction containing GoTaq® qPCR Master Mix (Promega, USA), cDNA ...
-
bioRxiv - Cancer Biology 2022Quote: ... Amplifications were performed in duplicates using GO taq QPCR master mix (Promega, A6002, lot no. 0000385100) and light cycler 480 II (Roche ...
-
bioRxiv - Immunology 2022Quote: ... Target gene expression was determined by quantitative RT-PCR using GoTaq qPCR Master mix (Promega, A6002) on a QuantStudio 5 Real-Time PCR System (Applied Biosystems ...
-
bioRxiv - Cancer Biology 2023Quote: ... Then prepared cDNA was subjected to real-time PCR analysis with Eastep qPCR Master Mix (Promega) and primer mixtures (primer sequences are shown in table S2) ...
-
bioRxiv - Cell Biology 2023Quote: ... and served as the template for quantitative PCR (using GoTaq qPCR Master Mix, A6002, Promega, USA). Then ...
-
bioRxiv - Cell Biology 2023Quote: ... primers designed for the gene of interest (Table 1) and GoTaq(R) qPCR Master Mix (Promega). Samples were run on an AB 7300 Real Time PCR System (Applied Biosystems ...
-
bioRxiv - Molecular Biology 2020Quote: ... and used for qPCR (GoTaq qPCR Mix, Promega) using standard protocols ...
-
Pluripotent stem cell SOX9 and INS reporters facilitate differentiation into insulin-producing cellsbioRxiv - Developmental Biology 2021Quote: ... cDNA samples were then diluted to 2.5-5 ng/µl and measured in a qPCR reaction with the GoTaq® qPCR Master Mix (Promega, Walldorf, Germany). All reactions were performed by a 2-step PCR in triplicates followed by melting curve analysis on a ViiA7 real-time PCR cycler (Thermo Fisher Scientific) ...
-
bioRxiv - Cell Biology 2021Quote: ... AtLPAAT4 and AtLPAAT5 by RT-qPCRs were performed with the Bio-Rad CFX96 real-time system using GoTaq® qPCR Master mix (Promega # A6002). The specific primer pairs used for AtLPAAT2 ...
-
bioRxiv - Cancer Biology 2019Quote: ... The new-synthesized cDNA products were further used as the templates of real-time quantitative PCR (qPCR) in the GoTaq®qPCR Master Mix (Promega, USA) containing each pair of the indicated primers (with specific nucleotide sequences as listed in Table 1) ...
-
bioRxiv - Pathology 2020Quote: ... GoTaq® Hot Start Master Mixes 2x (Promega), specific primers (5’ CGCATATGATGGAGCACGTGCA 3’ and 5’ CGGGATCCCTACAGTTTGGCG ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... PCRs were performed with the GoTaq G2 Hot Start Green Master Mix (Promega, Madison, WI, USA) in an Applied Biosystems 2720 Thermal Cycler (Thermo Fisher Scientific ...
-
bioRxiv - Developmental Biology 2020Quote: ... The PCR reactions were performed using GoTaq®G2 Green Master Mix (Promega, WI, USA; #M7823) or Taq 2x Master Mix Kit (New England Biolabs® Inc. ...
-
bioRxiv - Physiology 2019Quote: ... Eluted DNA as well as pre-IP controls were amplified using GoTaq Green Master Mix (Promega) with primers designed for the promoter regions of Ucp1 and Sarcolipin ...
-
bioRxiv - Microbiology 2021Quote: ... PCR verifying experiments were performed with Go Taq Green Master Mix (Promega, Charbonnières les Bains, France), and PCRs requiring proofreading were performed with the Q5® High-Fidelity DNA Polymerase (New England BioLabs ...
-
bioRxiv - Microbiology 2022Quote: ... 2 μl of the gDNA were added to a GoTaq® Green Master Mix (Promega, USA) and used to amplify part of the mitochondrial cytochrome oxidase 1 (CO1 ...
-
bioRxiv - Microbiology 2021Quote: ... The amplification was carried out in triplicate using GoTaq® Green Master Mix (Promega, Madison, WI) as previously described [32] ...
-
bioRxiv - Synthetic Biology 2021Quote: ... The Mobius Assemblies were verified first by colony PCR using GoTaq® Green Master Mix (Promega) and then with double restriction digestion with EcoRI-HF (NEB ...
-
bioRxiv - Plant Biology 2021Quote: ... PCR reaction mixture was formulated using 5 μl GoTaq G2 green PCR master-mix (Promega, USA), 1 μl primer (forward and revers ...
-
bioRxiv - Microbiology 2022Quote: ... the 16s rRNA gene region was PCR amplified with GoTaq Green Master Mix (Promega, Madison, WI), 16S rRNA gene primers 27F (AGAGTTTGATCMTGGCTCAG ...
-
bioRxiv - Molecular Biology 2022Quote: ... Colonies were screened by PCR screening using GoTaq G2 Hot Start green Master Mix (M7422, Promega) using the consensus pLKO F oligonucleotide (5’->3’GACTATCATATGCTTACCGT ...
-
bioRxiv - Plant Biology 2024Quote: ... PCR reactions (25 µL) were set up with GoTaq Green Master Mix (Promega, Madison, WI, USA), 200 nM of forward and reverse primers (Table S40) ...
-
bioRxiv - Genetics 2022Quote: ... using a 2x GoTaq G2 Green premix (Promega). 5 μl of the PCR products were used for restriction fragment length polymorphism assay with the appropriate enzymes ...
-
bioRxiv - Bioengineering 2021Quote: ... The results were calculated using the 2-△△CT method according to the GoTaq qPCR Master Mix (Promega) manufacturer’s specifications.
-
bioRxiv - Developmental Biology 2022Quote: ... The results were calculated using the 2-ΔΔCT method according to the GoTaq qPCR Master Mix (Promega) manufacturer’s specifications.
-
bioRxiv - Immunology 2020Quote: ... Bacterial groups in cecal samples were measured by real-time PCR using GoTaq qPCR Master Mix (Promega) on Applied Biosystem 7900HT Fast or StepOne Plus™ Real-Time PCR Systems ...
-
bioRxiv - Molecular Biology 2019Quote: ... PCR amplification was performed in 10 μL reactions comprising of 1X GoTaq® qPCR master mix (Promega), 1 μM of gene specific forward and reverse primers (sequences are provided in Supplementary Table 3 ...
-
bioRxiv - Genomics 2021Quote: ... Diluted cDNA (1:20) was used in a PCR reaction with the GoTaq qPCR Master Mix (Promega) and run on a CFX384 Touch instrument (Bio-Rad).
-
bioRxiv - Bioengineering 2021Quote: ... The results were calculated using the 2-△△CT method according to the GoTaq qPCR Master Mix (Promega) manufacturer’s specifications.
-
bioRxiv - Cell Biology 2021Quote: The qRT-PCR reaction was carried out with GoTaq®qPCR Master Mix (Promega, Madison, WI, USA) on a CFX96 instrument (Bio-Rad ...
-
bioRxiv - Cancer Biology 2023Quote: ... Then the eluted DNA was subjected to real-time PCR analysis with Eastep qPCR Master Mix (Promega) and promoter-specific primer mixtures ...
-
bioRxiv - Genetics 2022Quote: Quantitative PCR was performed on the Roche LightCycler 96 instrument by using GoTaq qPCR Master Mix (Promega) with 1µl cDNA template and 0.5µl of 10mM each primer in a total volume of 25µl reaction ...
-
bioRxiv - Physiology 2023Quote: ... Each 10 µl PCR reaction consisted of 5 µl of GoTaq® qPCR Master Mix (Promega Corporation), 0.5 µl of 10 µM forward primer ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... and GoTaq qPCR mix (Promega). Expression levels were calculated relative to the normalisation genes Afr-myosin or Afr-tubulin ...
-
bioRxiv - Molecular Biology 2022Quote: ... using GoTaq qPCR Mix (Promega), according to the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2019Quote: ... qPCR amplifications (12 μl) were done in duplicates using 1 μl of cDNA and the GoTaq Probe 2X Master Mix (Promega) on a LightCycler 480 (Roche) ...
-
bioRxiv - Microbiology 2023Quote: ... The PCR reaction was performed in 25 μL final volumes and consisted of 12.5 μL GoTaq® G2 Hot Start Colorless Master Mix (2X - Promega), 1 μL of each primer (10 μM) ...
-
bioRxiv - Plant Biology 2023Quote: ... PCR reactions were conducted in 10 μL volume comprising 5 μL Promega 2x PCR Master Mix (Promega, Madison, Wisconsin, USA), 10 pmol of forward and reverse primers ...
-
bioRxiv - Developmental Biology 2021Quote: ... or Gotaq Master Mix (Promega) and then subjected to 2% agarose gel electrophoresis ...
-
bioRxiv - Plant Biology 2022Quote: ... 1X GoTaq Master Mix (Promega), and 500nM each of forward and reverse primers ...
-
bioRxiv - Genetics 2021Quote: ... GoTaq® Master Mix (PROMEGA) 1X and 0.2 µM of each primer ...
-
bioRxiv - Molecular Biology 2020Quote: ... using GoTaq Master Mix (Promega) with the gene specific primers (Table 1).
-
bioRxiv - Genetics 2022Quote: ... 10 μl 2x GoTaq® Master Mixes (Promega, M7123), and 6 μl water ...
-
bioRxiv - Microbiology 2023Quote: ... 10 µL 2X master mixture (Promega, Madison, WI, USA), 1 µL forward and reverse primers (for each ...
-
bioRxiv - Epidemiology 2019Quote: ... The PCRs were run in a total volume of 25uL containing GoTaq Green Master Mix (Promega M712), primers ...
-
bioRxiv - Plant Biology 2021Quote: ... RT-PCR was performed with the GoTaq® Green Master Mix as per manufacturer’s instructions (Promega, USA). For RIP analysis ...