Labshake search
Citations for Promega :
351 - 400 of 1464 citations for 2x SYBR Green qPCR Master Mix since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2021Quote: ... Quantitative RT-PCRs were performed with the GoTaq qPCR Master Mix (Promega), 2% of cDNA per reaction ...
-
bioRxiv - Neuroscience 2021Quote: ... Real-time PCR analysis was performed with GoTaq qPCR master mix (Promega) on a CFX384 system (Bio-Rad) ...
-
bioRxiv - Plant Biology 2020Quote: ... Quantitative real-time PCR was performed using GoTaq qPCR Master Mix (Promega) at 58oC annealing temperature on LightCycler480 instrument (Roche) ...
-
bioRxiv - Microbiology 2020Quote: ... and 10 μL GoTaq Probe qPCR master mix (Promega, Madison, WI, USA). The amplification protocol consisted of 50 cycles of denaturation at 95°C for 3 s and annealing and extension at 60°C for 20 s.
-
bioRxiv - Neuroscience 2021Quote: ... Real-time PCR analysis was performed with GoTaq qPCR master mix (Promega) on a CFX384 system (Bio-Rad) ...
-
bioRxiv - Cell Biology 2022Quote: Real-time PCR was performed using the GoTaq qPCR Master Mix (Promega) according to manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2021Quote: ... 60°C for 1 minute) using Go-Taq qPCR Master Mix (Promega) on a QuantStudio™ 7 Flex Real Time PCR System (ThermoFisher Scientific) ...
-
bioRxiv - Molecular Biology 2020Quote: ... Real-time PCR was performed with the GoTag qPCR Master Mix (Promega) and measured on a LightCycler480 instrument (Roche ...
-
bioRxiv - Genetics 2020Quote: ... Real-time quantitative PCR was performed with GoTaq qPCR Master Mix (Promega) by Mx3000P QPCR System (Agilent Technologies) ...
-
bioRxiv - Developmental Biology 2019Quote: ... Real-time PCR was performed using GoTaq qPCR Master Mix (Promega, USA) and oligonucleotide primers specifically designed to amplify the homologues of ANO1 ...
-
bioRxiv - Genomics 2021Quote: ... using the GoTaq® qPCR Master Mix kit (Promega, cat. no. A6002). The expression of HPRT1 was used as an internal control for normalization ...
-
bioRxiv - Cancer Biology 2021Quote: ... qRT-PCR was performed with GoTaq® qPCR Master Mix (Promega, USA) using an iQ5 Real-Time PCR Detection System (BioRad ...
-
bioRxiv - Cancer Biology 2020Quote: ... Real time PCR was performed with GoTaq qPCR Master Mix (A6001, Promega) using CFX Connect Detection System (1855201 ...
-
bioRxiv - Molecular Biology 2023Quote: ... in 384-well plates using the GoTaq qPCR Master Mix (A6002, Promega). Primers were designed by the Primer-BLAST tool (https://www.ncbi.nlm.nih.gov/tools/primer-blast/index.cgi ...
-
bioRxiv - Developmental Biology 2022Quote: ... and performed PCR with GoTaq® qPCR Master Mix (Promega, Madison, WI). PCR primers are listed in Table S1 ...
-
bioRxiv - Cell Biology 2019Quote: ... The cDNA was proceeded by using a standard qPCR method with GoTaq qPCR master mix (Promega, A6002) and the CFX96 BioRad CFX 96 Real-Time PCR detection system ...
-
bioRxiv - Genetics 2022Quote: ... DNA (50 ng) was amplified using 1X GoTaq Green Master Mix (Promega), 0.8 μM oligonucleotides and 5% DMSO up to a volume of 20 μL ...
-
bioRxiv - Plant Biology 2022Quote: ... PCR followed standard conditions using GoTaq®Green Master Mix (Promega corp.), Ta= 58°C ...
-
bioRxiv - Cell Biology 2022Quote: ... Genomic PCR was carried out using GoTaq HotStart Green Master Mix (Promega), as per manufacturer’s instruction (TRAIP F ...
-
bioRxiv - Microbiology 2020Quote: ... containing 13.5 μL of GoTaq Green Master Mix (Promega, Cat No.: M7123), 1.5 μL of Human GAPDH Forward Primer (5’– AGAAGGCTGGGGCTCATTTG–3’) ...
-
Cholesterol deprivation induces TGFβ signaling to promote basal differentiation in pancreatic cancerbioRxiv - Cancer Biology 2019Quote: ... for LSL-KRas construct detection and GoTaq Green Master Mix (#M7122, Promega) for all other constructs.
-
bioRxiv - Evolutionary Biology 2020Quote: ... Standard PCR reactions were performed using Go Taq Green Master Mix (Promega) and 0.5μmol L−1 of the primer ...
-
bioRxiv - Neuroscience 2023Quote: The PCR was performed with the GoTaq® Green Master Mix (Promega), and the primers used for genotyping were as follows ...
-
bioRxiv - Physiology 2022Quote: ... PCR was performed using Go-Taq Green Master Mix (Promega, Madison, WI) and resulting products were resolved by 3% agarose gel electrophoresis ...
-
bioRxiv - Synthetic Biology 2023Quote: ... The PCR analysis was performed using the GoTaq Green Master Mix (Promega). Segregation primers (Supplementary Table S1 ...
-
bioRxiv - Genetics 2024Quote: ... PCR was performed using Go-Taq Green Master Mix (Promega, Madison, WI) and resulting products were resolved by 3% agarose gel electrophoresis ...
-
bioRxiv - Developmental Biology 2023Quote: ... All PCR reactions were performed using GoTaq Green Master Mix (Promega, M7123) with 0.25 ng total cDNA per reaction ...
-
bioRxiv - Microbiology 2019Quote: ... The semi-quantitative RT-PCR using 2X PCR Master Mix (Promega Corporation, Madison, WI, USA) and primers was carried out in a 20 μL reaction volume (1 μL cDNA ...
-
bioRxiv - Cell Biology 2022Quote: ... Quantitative real time-PCR was performed using GoTaq® qPCR Master Mix (Promega) in a QuantStudio 6 Flex thermocycler (Applied Biosystem ...
-
bioRxiv - Cell Biology 2019Quote: ... RT-PCR reactions were conducted using the GoTaq qPCR Master Mix (A6001, Promega) and a MasterCycler Ep-Realplex thermal cycler (Eppendorf).
-
bioRxiv - Cancer Biology 2020Quote: SqRT-PCR was performed using the GoTaq® qPCR Master Mix (Promega, TM318), according to the manufacturer’s protocol ...
-
bioRxiv - Plant Biology 2020Quote: ... qRT-PCR analysis was performed using GoTaq® qPCR Master Mix (Promega, WI) with Light Cycler 96 (Roche Life Science ...
-
bioRxiv - Molecular Biology 2020Quote: ... All the samples were analyzed in triplicate using GoTaq qPCR Master Mix (Promega) on an ABI 7300 system (Applied Biosystems) ...
-
bioRxiv - Cancer Biology 2022Quote: ... and analyzed by SYBRG real-time PCR using GoTaq qPCR Master Mix (Promega). Primers used are provided in supplementary table S3.
-
bioRxiv - Neuroscience 2020Quote: ... RT-PCR was performed using GoTaq® qPCR Master Mix (Promega, Shanghai, China) and specific primers (Sangon Biotech ...
-
bioRxiv - Microbiology 2020Quote: ... Semi-quantitative real-time PCR was performed using GoTaq qPCR Master Mix (Promega) using primers targeting the SARS-CoV-2 E protein gene (forward primer ...
-
bioRxiv - Developmental Biology 2022Quote: ... Quantitative real time-PCR was performed using Go-Taq qPCR Master Mix (Promega) in a QuantStudio 6 Flex thermocycler (Applied Biosystem) ...
-
bioRxiv - Immunology 2020Quote: ... Samples were analyzed by real-time PCR with GoTaq qPCR Master Mix (Promega) on the Applied Biosystem 7900HT Fast machine ...
-
bioRxiv - Cell Biology 2019Quote: ... using primers specific to individual genes and GoTaq® qPCR Master Mix (Promega). The incubation and cycling conditions were set as described in the kit and the plates were analysed in a StepOnePlus Real-Time PCR System (Thermo Scientific).
-
bioRxiv - Developmental Biology 2019Quote: ... amplification reactions (10 μl) prepared with the GoTaq Probe qPCR Master Mix (Promega) were run in a StepOnePlus Real-Time PCR System (Applied Biosystems) ...
-
bioRxiv - Microbiology 2021Quote: ... Real time-polymerase chain reactions were performed with GoTaq qPCR Master Mix (Promega) according to the manufacturer’s instructions and completed on QuantStudio 6 Flex system (ABI) ...
-
bioRxiv - Cell Biology 2022Quote: ... DNA was amplified using GoTaq Probe qPCR Master Mix (Promega, Leiden, the Netherlands) and TaqMan Gene Expression Assay (Thermo Scientific ...
-
bioRxiv - Biochemistry 2023Quote: ... The reactions were up in triplicate with the GoTaq qPCR Master Mix (Promega) and run on AriaMx Real-time PCR (Agilent) ...
-
bioRxiv - Cancer Biology 2023Quote: ... and analysed by SYBRG real-time PCR using GoTaq qPCR Master Mix (Promega). Primers used are provided in supplementary Table S2.
-
bioRxiv - Microbiology 2023Quote: ... Real time quantitative PCR was performed using GoTaq qPCR Master mix kit (Promega) in a CFX Connect Real-Time PCR thermocycler (BioRad) ...
-
bioRxiv - Neuroscience 2023Quote: ... and accompanying BioRad CFX Manager (v3.1) using GoTaq qPCR master mix (Promega, A6001) with the primers qPCR_appb_F2 (5’-CGTGGTCATCGCTACTGTCA ...
-
bioRxiv - Molecular Biology 2023Quote: QRT-PCR was performed using the GoTaq qPCR Master Mix (Promega, Cat# A6002) on a QuantStudio 5 Real-Time PCR System (Applied Biosystems) ...
-
bioRxiv - Plant Biology 2021Quote: The SCYLV titer in each sample was determined by qPCR using GoTaq qPCR Master Mix (Promega, Madison, USA) on a Bio-Rad CFX384 Touch detection system (Bio-Rad ...
-
bioRxiv - Neuroscience 2020Quote: ... RT-qPCR was performed on the ViiA 7 Real-Time PCR System using GoTaq qPCR master mix (Promega) according to the manufacturer’s protocols ...
-
bioRxiv - Microbiology 2020Quote: ... cDNA was diluted 1:5 before quantitative analysis by qPCR was done using GoTaq qPCR Master Mix (Promega) following manufacturer’s recommendations ...