Labshake search
Citations for Promega :
5451 - 5500 of 10000+ citations since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2023Quote: Reduced and alkylated proteins were in-gel digested with 100ng trypsin (modified sequencing grade, Promega) overnight at 37° C ...
-
bioRxiv - Microbiology 2023Quote: ... The plate was incubated in a plate reader (Amsterdam: Multiskan microplate photometer, Thermo Fisher; Ghent University: GloMax® Explorer Multimode Microplate Reader, Promega) at 37 °C and absorption was measured at 600 nm ...
-
bioRxiv - Microbiology 2023Quote: ... RNA extraction was performed with the Maxwell RSC PureFood GMO and Authentication kit using a Maxwell RSC instrument (Promega France ...
-
bioRxiv - Microbiology 2023Quote: ... vigorously vortexed for 1 min and mixed with 40 μL of Proteinase K Solution (Promega France ...
-
bioRxiv - Microbiology 2023Quote: ... The supernatant was removed and subjected to a Wizard Genomic DNA Purification Kit (Promega Catalog No. A1120) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: ... RNAseA (Thermo) and DNAseI (Promega) were used to treat nucleic acid extracts where indicated ...
-
bioRxiv - Microbiology 2023Quote: ... viral titers were determined by infecting MDCK cells and measuring reporter activity using the Nano-Glo luciferase assay (Promega)86,91 ...
-
bioRxiv - Microbiology 2023Quote: ... Caspase 3/7 enzymatic activity in raw cell lysates was measured using a Caspase Glo 3/7 assay kit (Promega) according to the manufacturer’s recommendations ...
-
bioRxiv - Immunology 2023Quote: ... reverse primer – GCTTCATCTCAACCTCCGTC) using genomic DNA from monocytes and ligated in dual luciferase reporter vector psiCHECK-2 downstream of Renilla luciferase (Promega Corporation) vector in Xho1 and Not1 sites in MCS ...
-
bioRxiv - Immunology 2023Quote: ... 100 μL supernatant was removed from each well and 30 μL of Bright-Glo (Promega #E2620) was added ...
-
bioRxiv - Immunology 2023Quote: ... pI.18-3xFlag-myRIG-I or pI.18-3xFlag-roRIG-I together with transfection control pLR-SV40-Renilla (Promega) and either of the reporter plasmids ISG54-Luc (69) ...
-
bioRxiv - Immunology 2023Quote: ... cDNA was synthesized using a MMLV reverse transcriptase (Promega, Madison, WI). Real-time PCR was performed using Radiant qPCR mastermix (Alkali Scientific ...
-
bioRxiv - Immunology 2023Quote: ... 2.5 μg pAdVantage (Promega), 30 μl of P3000 Reagent (Thermo Fisher Scientific) ...
-
The tetrapeptide sequence of IL-1β regulates its recruitment and activation by inflammatory caspasesbioRxiv - Immunology 2023Quote: ... FuGENE HD (Promega, E2311), AP20187 (Tocris™ 6297/5) ...
-
bioRxiv - Molecular Biology 2023Quote: ... 1M Tris-HCl was added to adjust the pH and 5 μL trypsin (2.5 ug, Promega Sequence Grade) was added and the samples digested overnight at 37℃ ...
-
bioRxiv - Systems Biology 2023Quote: ... 200 μM dNTP (Promega, Madison, WI, USA), 2.5mM MgCl2 ...
-
bioRxiv - Synthetic Biology 2023Quote: ... 0.3 mg/ml boiled herring sperm DNA (Promega) with about 200 ng pWS174 digested with Esp3I (Cas9 plasmid) ...
-
bioRxiv - Microbiology 2023Quote: ... and TCID50 equivalents determined using a SARS-CoV-2 E gene detection kit (Promega) based upon the Berlin primer/ probe set (70).
-
bioRxiv - Molecular Biology 2023Quote: ... using SYBR qPCR master mix (Promega, Cat No. #4367659). All values were obtained in triplicate ...
-
bioRxiv - Molecular Biology 2023Quote: ... cells were harvested and lysed in Passive Lysis Buffer (Promega). The activity levels of the Renilla (RL ...
-
bioRxiv - Molecular Biology 2023Quote: ... The activity levels of the Renilla (RL) and firefly (FL) luciferase was measured using a Dual-Luciferase Assay (Promega). For mRNA decay assays ...
-
bioRxiv - Molecular Biology 2023Quote: ... Gaussia luciferase activity in the supernatants was measured by addition of Coelenterazine (PJK Biotech) and firefly luciferase activity was measured in the cells using the Luciferase Assay System (Promega) according to the manufacturer’s instruction.
-
bioRxiv - Molecular Biology 2023Quote: ... and cells were lysed in 100 μl 1x Passive Lysis Buffer (Promega). Gaussia luciferase activity in the supernatants was measured by addition of Coelenterazine (PJK Biotech ...
-
Analysis of spike protein variants evolved in a novel mouse model of persistent SARS-CoV-2 infectionbioRxiv - Microbiology 2023Quote: ... 10 µL of GoTaq Probe qPCR Master Mix (Promega, A6101) was added to 10 µL of the reaction mixture containing 125 nM each of the forward and reverse primers ...
-
bioRxiv - Microbiology 2023Quote: ... 40 μl TnT® Quick Master Mix (L1170, Promega), 1 μl Methionine (1 mM) ...
-
bioRxiv - Molecular Biology 2023Quote: Genomic DNA was extracted from Tetrahymena WT (SB210, with or without BrdU-labeling) and ΔAMT1 cells using Wizard® Genomic DNA Purification Kit (Promega, A1120), sheared to 3-5kb in length with Megaruptor (Diagenode Diagnostics) ...
-
bioRxiv - Molecular Biology 2023Quote: ... with random primers (Promega, Charbonnières-les-bains, France).
-
bioRxiv - Neuroscience 2023Quote: ... The revers transcription (RT) reaction was performed by M-MLV reverse transcription kit (Promega, Madison, WI, USA).
-
bioRxiv - Neuroscience 2023Quote: ... 1ug of total RNA extracted from transfected SK-N-MC cells was reverse transcribed using the ImProm-II Reverse Transcription System and random hexamer primers (Promega, Madison, MI). PowerUp SYBR™ Green Master Mix (Thermo Fisher ...
-
α-synuclein expression in response to bacterial ligands and metabolites in gut enteroendocrine cellsbioRxiv - Neuroscience 2023Quote: Cell viability was assessed by Resazurin Reduction Assay (RRA) using a CellTiter-Blue® Cell Viability Assay (Promega) according to the manufacturer’s instructions.
-
bioRxiv - Neuroscience 2023Quote: ... cells were processed with Bright-Glo luciferase system (Promega) according to the manufacturers protocol ...
-
bioRxiv - Neuroscience 2023Quote: ... RT-PCR with random primers (Promega, Madison, WI, USA) and Moloney murine leukemia virus M-MLV reverse transcriptase (Promega ...
-
bioRxiv - Neuroscience 2023Quote: ... and Moloney murine leukemia virus M-MLV reverse transcriptase (Promega, Madison, WI, USA) was performed according to the vendor’s protocol ...
-
bioRxiv - Neuroscience 2023Quote: ... digested using 20 ng/μL sequencing grade trypsin (Promega) for 1 hr at 47C ...
-
bioRxiv - Neuroscience 2023Quote: ... we conducted a Luciferase Assay Report using the CellTiter-Glo 2.0 Assay (Promega #G9242) and Renilla luciferase assay system (Promega #E2820) ...
-
bioRxiv - Neuroscience 2023Quote: ... and Renilla luciferase assay system (Promega #E2820). Relative Luminesce Unit (RLU ...
-
bioRxiv - Neuroscience 2023Quote: ... 10µl of luciferase containing culture medium was transferred into a fresh 96 well plate and incubated with either Furimazine (Nano-Glo™ Luciferase Assay, Promega)/Coelenterazine (Prolume ...
-
bioRxiv - Neuroscience 2023Quote: ... A fragment of the rat Piezo 1 cDNA was amplified with Taq Polymerase and the oligonucleotide primers 5’-GAGGAAGAGGACTACCTT and 5’-TTTACTTAGAAAACCCTACAG from bladder total RNA and cloned into the pGEM-T Easy vector (Promega, Madison, WI). Sequence was confirmed by Sanger capillary sequencing and sense and antisense RNA probes were synthesized with T7 and SP6 RNA polymerases (Roche-Sigma-Aldrich) ...
-
bioRxiv - Neuroscience 2023Quote: ... and Moloney murine leukemia virus MMLV reverse transcriptase (Promega) was performed according to the vendor’s protocol.
-
bioRxiv - Neuroscience 2023Quote: ... RT-PCR with random primers (Promega, Madison, WI, USA) and Moloney murine leukemia virus MMLV reverse transcriptase (Promega ...
-
bioRxiv - Microbiology 2023Quote: ... Survival was assessed by ATP luminescent cell viability assay (CellTiter-Glo®, Promega). Half maximal inhibitory concentration (IC50 ...
-
bioRxiv - Microbiology 2023Quote: ... The samples were subjected to mechanical cell disruption by bead beating using EZ-Beads (Promega, Madison, WI, USA), followed by DNA purification using a Maxwell RSC Blood DNA kit (Promega).
-
bioRxiv - Microbiology 2023Quote: ... followed by DNA purification using a Maxwell RSC Blood DNA kit (Promega).
-
bioRxiv - Microbiology 2023Quote: ... The samples were eluted with TN buffer (10 mM Tris-HCl, pH 8.0, 50 mM NaCl) and quantified using the QuantiFluor ONE dsDNA System (Promega). The resulting barcoded DNA samples were combined in approximately equimolar amounts (a total of 100 femtomoles in 10 µl of TN buffer) ...
-
bioRxiv - Microbiology 2023Quote: ... the infected cells were lysed with a Bright-Glo Luciferase Assay System (Promega, cat# E2620) and the luminescent signal was measured using a GloMax Explorer Multimode Microplate Reader (Promega).
-
bioRxiv - Microbiology 2023Quote: ... and the luminescent signal was measured using a GloMax Explorer Multimode Microplate Reader (Promega).
-
bioRxiv - Microbiology 2023Quote: ... the amount of input virus was normalized to the HiBiT value measured by Nano Glo HiBiT lytic detection system (Promega, Cat# N3040)] ...
-
bioRxiv - Microbiology 2023Quote: Genomic DNA was purified using a Wizard genomic DNA purification kit (Promega). DNA was tagged and multiplexed with the Nextera XT DNA kit (Illumina) ...
-
bioRxiv - Neuroscience 2023Quote: ... Porcine trypsin (Promega) in 50 mM TEAB ...
-
bioRxiv - Pathology 2023Quote: ... 0.4 U.µL-1 of Taq polymerase (GoTaq, Promega), 200 µM of dNTPs ...