Labshake search
Citations for Roche :
1701 - 1750 of 7633 citations for ssc mir 758 Real time RT PCR Detection Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2020Quote: TUNEL staining was performed according to the manufacturer’s instructions (In Situ Cell Death Detection Kit, Fluorescein, Roche, #11 684 795 910). In brief ...
-
bioRxiv - Neuroscience 2021Quote: Cytotoxicity in the cell cultures (primary cortical neurons and cell lines) was assessed using the cytotoxicity lactate dehydrogenase (LDH) detection kit according to the manufacturer’s instructions (Roche, Basel, Switzerland). Furthermore ...
-
bioRxiv - Immunology 2020Quote: ... For immunohistochemistry paraffin-embedded normal human skin and ES was stained for human Cytokeratin 5/6 according to the manufacturer’s protocol using a Ventana BenchMark Series automated slide stainer with ultraView Universal DAB Detection kit (Roche, 760-500).
-
bioRxiv - Cancer Biology 2020Quote: Cell (1 × 104) proliferation was measured using the 5-Bromo-2′-deoxy-uridine Labeling and Detection Kit III (Roche, Mannheim, Germany) (Jin ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... assay [31] was performed on cryosections of retinal explants using an in situ cell death detection kit conjugated with fluorescein isothiocyanate (Roche, 11684795910). DAPI (Vectashield Antifade Mounting Medium with DAPI ...
-
bioRxiv - Plant Biology 2021Quote: ... Hybridization was conducted according to the procedures described in the DIG High Prime DNA Labeling and Detection Starter kit II protocol (Roche®), using a 725-bp C-terminal TalCMAI1 amplicon as probe (Yu et al ...
-
bioRxiv - Neuroscience 2020Quote: ... The stained cells were further labelled by TUNEL (TdT-mediated dUTP-X nick end labeling) with an In-Situ Cell Detection Kit (TMR red) from Roche (12156792910). Fluorescent images were collected on a Zeiss Automatic stage microscope with Zen blue software ...
-
bioRxiv - Cell Biology 2022Quote: TUNEL assay was performed on N153S and WT lumbar disc tissue sections using an in situ cell death detection kit (Roche Diagnostic). Briefly ...
-
bioRxiv - Neuroscience 2021Quote: Cytotoxicity in primary and cell line cultures was assessed using the cytotoxicity Lactate DeHydrogenase (LDH) detection kit according to the manufacturer’s instructions (Roche, Basel, Switzerland). The culture medium was centrifuged at 500xg for 5min to pellet cell debris before used in the experiments.
-
bioRxiv - Cell Biology 2022Quote: ... Gene expression was analyzed by LightCycler 480 SYBR Green Ⅰ Master kit with LightCycler 480 Detection System (Roche Diagnostics, Mannheim, Germany). qPCR values were normalized by GAPDH expression ...
-
bioRxiv - Genetics 2022Quote: ... Hybridization was performed as described in the Instruction Manual of the DIG High Prime DNA Labeling and Detection Starter Kit I (Roche Diagnostics). Washing conditions was performed according to Huang et al (Huang et al ...
-
bioRxiv - Animal Behavior and Cognition 2020Quote: ... The reagents were added in the dark according to the instructions of the In Situ Cell Death Detection Kit (Roche, US). Images were acquired under a fluorescence microscope.
-
bioRxiv - Plant Biology 2019Quote: ... The probes were labeled with digoxigenin (DIG) according to the manufacturer’s protocol (DIG High Prime DNA Labeling and Detection Starter Kit II, Roche, Basel, Switzerland). Northern blot procedures were performed as previously described (Jiang et al. ...
-
bioRxiv - Plant Biology 2019Quote: ... were used as templates to synthesis DIG-labeled probes according to the manufacturer’s protocol (DIG High Prime DNA Labeling and Detection Starter Kit II, Roche, Basel, Switzerland). ULTRAhyb®-Oligo Hybridization Buffer (Ambion ...
-
bioRxiv - Plant Biology 2022Quote: ... The products then transferred from the gel to Hybond N+ Nylon membrane (Amersham Biosciences) and detected using DIG Nucleic Acid Detection Kit (Roche Diagnostics) according to manufacturer’s protocol.
-
bioRxiv - Plant Biology 2022Quote: ... The products were then transferred from the gel to the Hybond N+ Nylon membrane (Amersham Biosciences) and detected using DIG Nucleic Acid Detection Kit (Roche Diagnostics), according to the manufacturer’s protocol.
-
bioRxiv - Molecular Biology 2023Quote: ... Cell death was determined by the TUNEL assay using the In Situ Cell Death Detection Kit Fluorescein (Cat # 11684795910; Roche, Germany); only a signal overlapping a DAPI-stained nucleus was considered positive ...
-
bioRxiv - Immunology 2023Quote: ... Apoptosis also was detected using a terminal deoxynucleotidyl transferase (TdT)-mediated deoxyuridine triphosphate (dUTP)-biotin nick end-labeling (TUNEL) assay with Cell Death Detection Kit (Roche, Germany). Nuclei were stained with 4-6-diamidino-2-phenylindole (DAPI ...
-
bioRxiv - Microbiology 2023Quote: ... Southern blotting was conducted to confirm the correct deletion using the digoxigenin (DIG) high prime DNA labeling and detection starter Kit I (11745832910 Roche Germany). The Myb gene complementation vectors were constructed by cloning the entire length of the target gene with the native promoter region (about 1.5-kb ...
-
bioRxiv - Developmental Biology 2023Quote: TUNEL staining was performed according to the manufacturer’s protocol with minor modifications (In Situ Cell Death Detection Kit, TMR red; catalogue number 12156792910; Roche, Mannheim, Germany). Briefly ...
-
bioRxiv - Cell Biology 2023Quote: ... samples were covered with the staining mixture at 37 °C for 1 h following instructions of the In Situ Cell Death Detection Kit (Roche, 11684795910). After the TUNEL reaction ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... Southern blotting was conducted to confirm the correct deletion using the digoxigenin (DIG) high prime DNA labelling and detection starter Kit I (11745832910 Roche Germany). The MYB gene complementation vectors were constructed by cloning the entire length of the target gene with the native promoter region (about 1.5-kb ...
-
bioRxiv - Immunology 2023Quote: ... Wells were pre-coated with 100 μL per well of capture anti-histone antibody contained in the Cell Death Detection ELISA kit (1:40 in 1x coating buffer; Roche 11544675001) or anti-myeloperoxidase (MPO ...
-
bioRxiv - Neuroscience 2024Quote: ... Tissues were washed three times with TBS-T and were incubated with a TUNEL reaction mixture (In Situ Cell Death Detection Kit, TMR red, Roche 12156792910) for 1 h at 37 °C ...
-
bioRxiv - Cancer Biology 2024Quote: ... The samples were developed by using either secondary antibodies linked to horseradish peroxidase with the UltraView™ Universal DAB Detection Kit (Ventana Medical System, Roche) or secondary antibodies linked to fluorophores ...
-
bioRxiv - Cell Biology 2024Quote: ... assay was performed following our previous publication(4, 55) and the instruction of In Situ Cell Death Detection Kit TMR red (Roche, 12156792910). Cells were cultured on coverslips for 36 h ...
-
bioRxiv - Immunology 2023Quote: ... DNA was incubated for 10 minutes at 65°C before performing RT qPCR using the KAPA SYBR FAST qPCR Kit from KAPA Biosystems. Primers used for real-time qPCR can be found in Supplementary Table 1.
-
bioRxiv - Molecular Biology 2019Quote: ... avian myeloblastosis virus reverse transcriptase (AMV RT; Roche) were used to synthesize cDNA from total RNA (2.5 µg ...
-
bioRxiv - Plant Biology 2021Quote: ... RT-qPCR was performed on a LightCycler480 (Roche) in a 10-μL reaction mixture containing 8 ng of cDNA ...
-
bioRxiv - Neuroscience 2019Quote: ... RT-qPCR was run using SYBR green (Roche) on a QuantStudio 6 (ThermoFisher ...
-
bioRxiv - Microbiology 2021Quote: ... RT-qPCR was performed using SYBR Green (Roche) and a QuantStudio 7 Flex (Life Technology ...
-
bioRxiv - Plant Biology 2019Quote: ... GUN1 protein was expressed in RTS ProteoMaster (Roche). Full-length GUN1 cDNA and N-terminal truncated versions as EcoRI-SalI PCR fragments were ligated into pET48b (Novagen ...
-
bioRxiv - Cell Biology 2022Quote: ... anti-HA (rt, 1:1000, Roche, clone 3F10), anti-CNG channel (ms ...
-
bioRxiv - Cancer Biology 2023Quote: ... RT-qPCR was run on Lightcycler 480 (Roche) using SYBR Green 1 Master Kit (Roche) ...
-
bioRxiv - Microbiology 2023Quote: ... or RevertAid RT (Thermo) with random hexamers (Roche). qPCR was performed with the SensiFAST No-ROX Probe Master Mix (Bioline ...
-
bioRxiv - Plant Biology 2020Quote: ... and identified by morphological features.41 Polymerase chain reaction (PCR) products were purified with the High Pure PCR Product Purification Kit (Roche Diagnostics, Mannheim, Germany), and sequenced in both directions by Macrogen Inc ...
-
bioRxiv - Plant Biology 2021Quote: ... Digoxigenin-11-dUTP (DIG) labeled DNA probes were generated using via PCR labelling using PCR DIG Probe Synthesis kit (Roche, catalogue no. 11636090910). 10 ng of purified plasmid DNA containing full length GFP DNA was used as PCR template and amplified with GFP forward (TCAAGGACGACGGGAACTACAAG ...
-
bioRxiv - Plant Biology 2022Quote: ... PCR reactions were performed using 50 ng of metagenomic DNA per sample using the Kapa HiFi HotStart PCR kit (Kapa Biosystems, Wilmington, USA). The individual PCR reactions were performed in 20 µL final volume and containing 4 µL of 5X Kapa HiFi Buffer ...
-
bioRxiv - Plant Biology 2019Quote: ... The cDNA was diluted 20-fold and used for qRT-PCR employing a LightCycler® 480 SYBR Green 1 Master PCR labelling kit (Roche Applied Sciences) and RotorGene 3000 Real time PCR machine (Corbett Research ...
-
bioRxiv - Zoology 2019Quote: ... PCR products were visualized on a 1.5% agarose gel and cleaned using the HiPure PCR product Cleanup kit (Roche Life Sciences, Indianapolis, IN) and sent for sequencing at Macrogen USA (Rockville ...
-
bioRxiv - Synthetic Biology 2019Quote: ... purified by gel electrophoresis and extracted from the gel via a commercial kit (HighPure PCR Product Purification Kit, Roche, DE). Sample preparation (Illumina TruSeq amplicon library ...
-
bioRxiv - Immunology 2021Quote: ... Each cDNA sample was ten times diluted and amplified using KAPA SYBR® FAST qPCR Kit (Kapa Biosystems) on the CFX Connect™ Real-Time PCR detection System (Bio-Rad) ...
-
bioRxiv - Systems Biology 2019Quote: mRNA was extracted at the indicated time points using the High Pure RNA Isolation kit (Roche, Mannheim, Germany). cDNA was generated using M-MuLV reverse transcriptase (NEB ...
-
bioRxiv - Cancer Biology 2020Quote: ... cDNAs diluted 2 times were examined by qPCR with the KAPA SYBR Fast qPCR Kit (Kapa Biosystems, K4602) using specific primers for β-actin ...
-
bioRxiv - Bioengineering 2021Quote: Total RNA was extracted at different time-points of cerebellar differentiation using High Pure RNA Isolation Kit (Roche) and converted into complementary cDNA with Transcriptor High Fidelity cDNA Synthesis Kit (Roche) ...
-
Optimized immunoglobulin knock-ins using Cas9 reveal peritoneal B cell lineage relationships in vivobioRxiv - Immunology 2021Quote: ... Custom DIG-labeled probes were generated using PCR DIG Probe Synthesis Kit (Roche #11636090910) and blots were hybridized for 16 hours at 48°C with a final concentration of 25ng/ml probe in 10ml DIG EasyHyb buffer rolling in hybridization tubes ...
-
bioRxiv - Developmental Biology 2020Quote: ... Each PCR product was ligated into Eam1105I-digested pJC53.2 vector (Quick Ligation Kit, Roche) for use in ISH and RNAi experiments (Collins et al. ...
-
bioRxiv - Molecular Biology 2020Quote: ... and libraries were quantified by Q-PCR using the Kapa Library Quantification Kit (Roche). RNA-seq experiments were performed on an Illumina HiSeq3000 using a paired-end read length of 2×150 pb.
-
bioRxiv - Molecular Biology 2021Quote: ... QHR-4C libraries were purified by the High-Pure PCR Product Purification kit (Roche).
-
bioRxiv - Genomics 2019Quote: ... Index tagged samples were amplified (6 cycles of PCR, KAPA HiFi kit, KAPA Biosystems), quantified (Accuclear dsDNA Quantitation Solution ...