Labshake search
Citations for Roche :
1901 - 1950 of 7633 citations for ssc mir 758 Real time RT PCR Detection Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2019Quote: ... and Discovery Teal detection systems according to manufacturer’s protocols (Roche). Antibodies ...
-
bioRxiv - Microbiology 2021Quote: ... Western-blot antibody detection was used using antibodies from Roche Diagnostics Mannheim Germany (Anti-HA ...
-
bioRxiv - Microbiology 2020Quote: ... Antibody binding was visualized with ECL light detection reagent (Roche) using Luminescent Image Analyzer (LAS-1000plus ...
-
bioRxiv - Microbiology 2021Quote: ... Proteins were visualized by Lumi-Light Plus detection reagent (Roche).
-
bioRxiv - Plant Biology 2020Quote: ... Detection was performed with the BM-chemiluminescence blotting substrate (Roche) and FusionFx7 imaging system (PeqLab) ...
-
bioRxiv - Physiology 2022Quote: ... qPCR analysis was performed using SYBR Green detection (04913914001, Roche) on a QuantStudio 6 system (Applied Biosystems ...
-
bioRxiv - Neuroscience 2024Quote: ... in the Light-Cycler 480 detection System (Roche, Basel, Switzerland). Ct data were calculated with the LightCycler 480 relative quantification software (Roche ...
-
bioRxiv - Cancer Biology 2021Quote: ... 5% CO2 by quantification of LDH released into cell supernatants by apoptotic/necrotic cells (LDH detection kit, Roche Applied Science, #11 644 793 001). Maximal lysis of the target cells (= 100% ...
-
bioRxiv - Microbiology 2020Quote: ... Terminal deoxynucleotidyl transferase dUTP nick end labeling (TUNEL) staining was conducted using an in-situ cell death detection kit (Roche, Indianapolis, Indiana, United States) as per the manufacturer’s instructions [31,34] ...
-
bioRxiv - Genomics 2022Quote: Terminal deoxynucleotidyl transferase dUTP nick end labelling (TUNEL) assay was performed using an in situ cell death detection kit (Fluorescein or TMR; Roche Diagnostics GmbH, Mannheim, Germany). Fixed slides were dried at 37°C for 30 min and rehydrated in phosphate-buffered saline (PBS ...
-
bioRxiv - Neuroscience 2023Quote: ... brain sections were processed for DNA strand breaks using Terminal deoxynucleotidyl transferase dUTP nick end labeling (TUNEL) from Fluorescence In Situ Cell Death Detection kit (Roche Diagnostic, Indianapolis, IN, US) according to the manufacturer’s instructions.
-
bioRxiv - Neuroscience 2022Quote: ... brain sections as previously described (46) (Iba-1 staining was conducted on a Ventana Benchmark using OptiView and UltraView detection kits provided by Roche (Roche Molecular Systems, Inc). Sections were deparaffinized in xylene and rehydrated through an ethanol series ending in distilled water ...
-
bioRxiv - Developmental Biology 2023Quote: ... Reverse transcription (RT) was performed from 2-3 µg of RNA with the Transcriptor First Strand cDNA Synthesis Kit (Roche Life Sciences, Basel, Switzerland) using random hexamer primers ...
-
bioRxiv - Molecular Biology 2019Quote: ... The RT-qPCR was run on a LightCycler 480 (Roche). GAPDH primers were used as an internal control ...
-
bioRxiv - Genomics 2021Quote: ... RT-qPCR were performed on the Light Cycler 480II (Roche) with the primers listed in Supplementary Data 6 using Eef1a1 and Hprt as housekeeping controls.
-
bioRxiv - Cancer Biology 2021Quote: ... RT-qPCR was carried out with SYBR Green I (Roche) and SuperScript IV Reverse Transcriptase (Invitrogen ...
-
bioRxiv - Molecular Biology 2020Quote: ... Subsequent RT-qPCR was performed on a LightCycler96 platform (Roche) based on SARS-CoV-2 N gene RNA amplification using forward (5’-GACCCCAAAATCAGCGAAAT ...
-
bioRxiv - Neuroscience 2022Quote: ... RT-qPCR was performed on a LightCycler 480 II (Roche) using LightCycler 480 SYBR Green I Master mix (Roche ...
-
bioRxiv - Cell Biology 2022Quote: ... RT-qPCR was performed in a LightCycler480 (Roche, Mannheim, Germany) using KAPA SYBR FAST Kit (KK4611 ...
-
bioRxiv - Microbiology 2019Quote: ... respectively with and without RT on a LightCycler 480 (Roche).
-
bioRxiv - Genetics 2020Quote: ... RT-qPCRs were performed on the Light Cycler 480II (Roche) using Eef1a1 and Hptr as housekeeping genes ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... In the following RT qPCR with a Light-Cycler480 (Roche) and Kapa SYBR Fast (Kapa Biosystems ...
-
bioRxiv - Molecular Biology 2021Quote: ... The RT-qPCR was conducted using LightCycler 480 Instrument (Roche) using the following conditions ...
-
bioRxiv - Immunology 2021Quote: ... RT-qPCR was performed using a Light Cycler 480 (Roche). Ten RNA copies was the lowest number used to calculate the standard curve.
-
bioRxiv - Immunology 2021Quote: ... RT-qPCR was performed using a Light Cycler 480 (Roche). Changes in relative gene expression were calculated according to the 2-ΔΔCT method (43).
-
bioRxiv - Plant Biology 2022Quote: ... RT-qPCRs were performed using SYBR® Green Mix (Roche) in a LightCycler® 480 (Roche) ...
-
ENGRAILED-1 transcription factor has a paracrine neurotrophic activity on adult spinal α-motoneuronsbioRxiv - Neuroscience 2023Quote: ... RT-qPCR was done using SYBR-Green (Roche Applied Science) and a Light Cycler 480 (Roche Applied Science) ...
-
bioRxiv - Plant Biology 2023Quote: ... RT-qPCR reactions were realized on LightCycler® 480 (Roche) with MESA FAST qPCR MasterMix Plus for SYBR® Assay No ROX (Eurogentec) ...
-
bioRxiv - Cell Biology 2024Quote: ... RT-qPCR was performed on a LightCycler 480 instrument (Roche) using SYBR Green I Master Mix (4887352001 ...
-
bioRxiv - Developmental Biology 2021Quote: ... and PCR enriched (8-10 cycles) using the KAPA Hyper Library Preparation kit (KAPA Biosystems, #KK8504). eCLIP libraries were prepared as described above according to (Van Nostrand et al. ...
-
bioRxiv - Immunology 2021Quote: ... Reverse: 3’-GGTCCACCAAACGTAATGCG-5’) were performed using KAPA SYBR FAST ONE-STEP qRT-PCR kits (Roche) according to manufacturer’s instructions on a Lightcycler 480 Instrument-II (Roche).
-
bioRxiv - Cancer Biology 2022Quote: Genomic DNA was extracted from 106 cells using High Pure PCR Template Preparation Kit (Roche, 11796828001). 150 ng of purified DNA was digested in Reaction Buffer (200 mM sodium acetate [pH 4.5] ...
-
bioRxiv - Microbiology 2022Quote: ... DNA probes were synthesised using the designed primers followed by PCR DIG-probe Synthesis kit (Roche) according to the manufacturer’s instructions in 50μl reaction volumes ...
-
bioRxiv - Microbiology 2021Quote: ... The DIG-labeled probe was synthesized using the PCR DIG probe synthesis kit (11636090910, Roche, Switzerland) and the following primers ...
-
bioRxiv - Microbiology 2021Quote: ... Emulsion PCR was performed using the GS FLX Titanium emPCR Kit Lib-L (Roche Applied Science) to enrich DNA library beads for the 454 GS-junior sequencers ...
-
bioRxiv - Pathology 2021Quote: DNA extraction and PCR were performed using Kapa mouse genotyping kit (Kapa Biosystems, Wilmington, MA, USA) according to the manufacturer protocol ...
-
bioRxiv - Cancer Biology 2022Quote: ... Purified libraries were normalized by quantitative PCR (qPCR) using the KAPA Library Quantification Kit (KAPA Biosystems) and diluted to a final concentration of 10 nM ...
-
bioRxiv - Biochemistry 2022Quote: DNA from liver and cell pellets was isolated using High Pure PCR Template Preparation Kit (Roche). DNA concentrations were measured by Nanodrop 2000c Spectrophotometer (Thermo Scientific) ...
-
bioRxiv - Cell Biology 2022Quote: ... qRT-PCR was conducted with the LightCycler 480 SYBR Green I Master kit (Cat. 04887352001, Roche). Primers used for qRT-PCR are listed in Supplementary Table 2 ...
-
RTEL-1 and DNA polymerase theta promote subtelomeric DNA synthesis and telomere fusion in C. elegansbioRxiv - Genetics 2022Quote: ... Probe was generated using the PCR DIG probe synthesis reaction kit (Roche cat# 11636090910, Basel, Switzerland). Tel2 (GAATAATGAGAATTTTCAGGC ...
-
bioRxiv - Plant Biology 2022Quote: ... The purified PCR products were used to construct libraries by the Kapa DNA Hyper Kit (Roche) together with TruSeq DNA UD indexes for Illumina (Illumina) ...
-
bioRxiv - Synthetic Biology 2023Quote: ... The qRT-PCR was performed using KAPA SYBR FAST qPCR Master Mix (2X) Kit (KAPA Biosystems) with StepOnePlus Real-Time PCR system (Applied Biosystems) ...
-
bioRxiv - Pathology 2023Quote: ... 2 canine gastrointestinal biopsies and 5 canine normal tissues (High Pure PCR Template Preparation Kit, Roche Applied Science ...
-
bioRxiv - Cell Biology 2023Quote: ... 25 μl reactions were prepared for each sublibrary with the KAPA HiFi PCR Kit (Roche, KK2502) containing 0.5 μl of the oligo pool resuspended to 20 ng/μl ...
-
bioRxiv - Cell Biology 2023Quote: ... 25 μl reactions were prepared for each sublibrary with the KAPA HiFi PCR Kit (Roche, KK2502) containing 0.5 μl of the oligo pool resuspended to 20 ng/μl ...
-
bioRxiv - Plant Biology 2023Quote: ... The purified PCR products were prepared for the libraries using the Kapa DNA Hyper Kit (Roche) utilizing indexes from TruSeq DNA UD indexes for Illumina (Illumina) ...
-
bioRxiv - Cancer Biology 2023Quote: ... full-length KILR was amplified from T47D cDNA using the KAPA HiFi PCR Kit (Kapa Biosystems) and KCTD1-5 cDNA was synthesized by IDT ...
-
bioRxiv - Molecular Biology 2023Quote: ... The resulting cDNA was purified using the High Pure PCR Product Purification Kit (Roche Applied Science) [44].
-
bioRxiv - Microbiology 2023Quote: ... Concentration of the pool was measured with quantitative PCR (KAPA Library Quantification Kit, Roche, Basel, Switzerland). Amplicon libraries were mixed with 5% PhiX and sequenced with MiSeq reagent kits v2 500 cycles (Illumina ...
-
bioRxiv - Immunology 2021Quote: ... concentrations measured in 100 ul of basolateral medium incubated with the reaction mixture of a cytotoxicity detection kit (Sigma-Aldrich, Roche, Saint Louis, MO, USA) following the manufacturer’s instructions ...