Labshake search
Citations for Roche :
1551 - 1600 of 7633 citations for ssc mir 758 Real time RT PCR Detection Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Evolutionary Biology 2020Quote: ... which was then amplified using the KAPA HiFi PCR Kits (Roche, USA). The amplified products were classified into different fragments according to their sizes (1~2 k ...
-
bioRxiv - Molecular Biology 2020Quote: ... DIG-labelled probe prepared using PCR DIG Probe Synthesis Kit (#11636090910, Roche) was added and the membranes incubated for over 18 h ...
-
bioRxiv - Bioengineering 2020Quote: ... using Expand High-Fidelity PCR Kit according to the manufacturer’s instructions (Roche). The PCR reaction consisted of 5 μl of 10x reaction buffer ...
-
bioRxiv - Cell Biology 2021Quote: ... with KAPA SYBR FAST One-Step qRT-PCR Kits (Kapa Biosystems, MI). NCX ...
-
bioRxiv - Cell Biology 2021Quote: ... gDNA was extracted using the High Pure PCR Template Preparation Kit (Roche) according to the manufacturer’s instructions.
-
bioRxiv - Microbiology 2021Quote: ... Amplicons were purified using the High Pure PCR Product Purification Kit (Roche) and afterwards restricted with BamHI (ThermoScientific ...
-
bioRxiv - Microbiology 2021Quote: ... using the KAPA SYBR FAST One-Step qRT-PCR kit (Kapa Biosystems) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: ... which were generated by a DNA-labelling PCR-Kit (Roche Life Science).
-
bioRxiv - Microbiology 2021Quote: ... and purified by High Pure PCR Product Purification Kit (Roche, Mannheim, Germany) according to manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2022Quote: ... bead washes and PCR amplification using the HyperCapture Target Enrichment Kit (Roche). Samples were sequenced by paired-end sequencing with a 300 cycle high-output Nextseq 500 kit (Illumina) ...
-
bioRxiv - Developmental Biology 2022Quote: ... cDNA was subject to PCR using a Taq DNA Polymerase kit (Roche) using primers specific for mouse Ocm and Glyceraldehyde 3-Phosphodehydrogenase (G3PDH) ...
-
bioRxiv - Microbiology 2021Quote: ... Amplicons were purified using the High Pure PCR Product Purification Kit (Roche) and afterwards restricted with EcoRI (New England Biolabs ...
-
bioRxiv - Genomics 2019Quote: ... All sequencing used PCR-free library preparation kits purchased from KAPA Biosystems, equivalent to the protocol in the Illumina TruSeq PCR-Free Sample Preparation Guide (Illumina cat# FC-121-2001) ...
-
bioRxiv - Molecular Biology 2019Quote: ... de-crosslinked and purified using High Pure PCR Cleanup Micro Kit (Roche). The libraries were prepared using TruSeq ChIP Sample Preparation Kit (Illumina ...
-
bioRxiv - Molecular Biology 2019Quote: ... The DNA was purified using High Pure PCR Cleanup Micro Kit (Roche). DNA libraries were prepared using TruSeq ChIP Sample Preparation Kit (Illumina ...
-
bioRxiv - Systems Biology 2022Quote: ... library preparation was performed using a KAPA HyperPrep Kit PCR-free (Roche) with a target insert size of 500 bp ...
-
bioRxiv - Cell Biology 2022Quote: ... and amplified for 15 cycles using KAPA HiFi PCR Kit (KAPA biosystems). cDNA was then separated into two fractions by size using 0.5X and 1X AMPure PB Beads (Pacific Scientific) ...
-
bioRxiv - Cancer Biology 2023Quote: ... qRT-PCR was performed using Kapa SYBR FAST qPCR kit (Kapa Biosystems).
-
bioRxiv - Genomics 2024Quote: ... All PCRs were performed using the KAPA HiFi Kit (Roche, Basel, Switzerland).
-
bioRxiv - Neuroscience 2019Quote: ... samples were pretreated with hybridization buffer (50% formaldehyde, 5 × SSC, 0.1% tween, 100 ug/ml tRNA [Roche], 50 ug/ml heparin [Sigma]) for 2 hr at 65°C ...
-
The conserved metalloprotease invadolysin is present in invertebrate haemolymph and vertebrate bloodbioRxiv - Cell Biology 2019Quote: ... with Lumi-Film Chemiluminescent detection film (Roche).
-
bioRxiv - Biochemistry 2021Quote: ... on a LightCycler 96 Detection System (Roche) was used for RT-qPCR ...
-
bioRxiv - Plant Biology 2021Quote: ... Signal detection was performed using CDPstar (Roche).
-
bioRxiv - Cell Biology 2019Quote: ... and In Situ Cell Death Detection (Roche) kits ...
-
bioRxiv - Cancer Biology 2022Quote: ... and a LightCycler480 Detection System (Roche, Germany). The relative expression of indicated genes was analyzed by the 2−ΔΔCt method ...
-
bioRxiv - Cell Biology 2024Quote: ... using the ECL detection system (Roche, Germany).
-
bioRxiv - Cell Biology 2019Quote: ... 4 μl 5xTranscriptor RT reaction buffer (Roche), 0.5 μl RNase OUT (Fisher) ...
-
bioRxiv - Neuroscience 2020Quote: ... RT-qPCR reactions on a LightCycler480 (Roche) to probe for the genes of interest (see Supplementary Table 1 for primer sequences) ...
-
bioRxiv - Biochemistry 2019Quote: ... The cDNA was then used to perform qRT PCR using the KAPA SYBR FAST qRT PCR master mix kit (KK4602, KAPA Biosystems) as per the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2020Quote: ... Fifty µl of cDNA were amplified by 13 PCR cycles with the Kapa HiFi PCR kit (Kapa Biosystems, Wilmington, MA, USA) followed by size selection from 1.5kb to 3.5kb with a BluePippin system (Sage Science ...
-
bioRxiv - Plant Biology 2022Quote: ... The primers designated ‘forward’ (GCCTTTTCAGCAAGATGCCG) and ‘reverse’ (GTACTCCCTCCGCTCCAAAAT) were used to perform PCR amplifications with the Kapa HiFi HotStart PCR kit (Kapa Biosystems, Roche). The reactions were performed in a SimpliAmp Thermal Cycler (Applied Biosystems ...
-
bioRxiv - Cell Biology 2021Quote: ... the small fragments from the cDNA amplification are purified and the library is barcoded and amplified using PCR with the KAPA high fidelity PCR kit(KAPA Biosystems). After all libraries are ready their quality and size are measured using the bioanalyzer before being sequenced on a NEXTseq (Illumina).
-
bioRxiv - Microbiology 2021Quote: The full-length hAce2 gene was PCR-amplified from Mammalian Gene Collection cDNA clone (clone number MGC:47598) using a Kapa HiFi PCR kit (Kapa Biosystems) with a primer pair (Forward ...
-
bioRxiv - Microbiology 2021Quote: ... the SARS-CoV-2 Spike gene with a 54-nucleotide deletion at the C-terminus was PCR-amplified from synthetic DNA (provided by Alex Ma, Academia Sinica, Taiwan) using the Kapa HiFi PCR kit (Kapa Biosystems) with a primer pair (Forward ...
-
bioRxiv - Genomics 2020Quote: ... a total of 1.0 μg of extracted DNA was used as the starting material for PCR-free library construction (KAPA HyperPrep PCR-Free Library Prep kit; Roche, #KK8505); libraries were then mechanically sheared (Covaris microtube system ...
-
bioRxiv - Cancer Biology 2022Quote: ... We next amplified full-length 1.7kb NT5C2 DNA insert by PCR using KAPA HiFi HotStart ReadyMix PCR Kit (Kapa Biosystems, #KK2601) and the following primers ...
-
bioRxiv - Neuroscience 2023Quote: A total of 1.0 µg of extracted DNA was used for PCR-free library construction using the KAPA HyperPrep PCR-Free Library Prep kit (Roche, KK8505). Mechanical shearing using the Covaris microtube system (Covaris ...
-
bioRxiv - Neuroscience 2024Quote: ... 5’-ATGGGCACCCAAAACAACAGT-3’ and 5’-GCGGCAGCACATATCCAAAAA-3’) was PCR amplified with a fast-cycling polymerase (KAPA2G Fast HotStart PCR kit, KAPA Biosystems) and a subsequent gel-electrophoresis ...
-
bioRxiv - Systems Biology 2021Quote: ... Real-time PCR analysis was performed using the LightCycler 480 SYBR Green I Master MIX and LightCycler 96 instrument from Roche (Basel, Switzerland), according to the manufacturer’s protocol with a final individual primer concentration of 0.5 μM ...
-
bioRxiv - Plant Biology 2022Quote: ... Real-time PCR was performed on cDNAs in a final volume of 10 µL using SYBR Green I master mix (Roche Life Science) and primers for AtCLCa gene ...
-
bioRxiv - Microbiology 2020Quote: ... Southern blotting was carried out using Hybond-N+ membrane (Amersham) and DIG High Prime DNA Labeling and Detection Starter kit II (Roche), following the indications of the manufacturer ...
-
bioRxiv - Cell Biology 2020Quote: ... were performed with the Ventana Bench-Mark XT automated staining system (Ventana) using the UltraView Universal DAB Detection Kit (Roche). For α-Syn ...
-
bioRxiv - Developmental Biology 2020Quote: ... gbx1 and pax6a digoxigenin and FITC antisense probes were generated from linearized plasmids using an RNA labelling and detection kit (Roche)87 ...
-
bioRxiv - Neuroscience 2021Quote: ... and then washed in PBS buffer before incubation with terminal deoxynucleotide transferase (In Situ Cell Death Detection kit; Roche, Switzerland) for 1 h at 37 °C in a solution containing TMR red dUTP ...
-
bioRxiv - Developmental Biology 2022Quote: ... samples were incubated with 27 µl labeling solution plus 3 µl enzyme solution (In Situ Cell Death Detection Kit, AP, Roche) at 37°C overnight ...
-
bioRxiv - Microbiology 2019Quote: ... The cytotoxic potential of the samples was determined from THP1-cell supernatants after 3 hours by using the Cytotoxicity Detection Kit (Roche) according to the manufacturer’s instructions.
-
bioRxiv - Developmental Biology 2019Quote: TUNEL assay for scoring apoptotic cells was performed using In situ cell death detection kit fluorescein (Roche, Catalog No.11684795910), as per manufacturer’s protocol.
-
bioRxiv - Immunology 2019Quote: PFA fixed zebrafish larvae were used in combination with the In situ Cell Death Detection Kit (TMR and Fluorescein) (Roche). After O/N fixation larvae were washed and permeabilized for 45 min at 37°C using Proteinase K ...
-
Dual functionality of the TasA amyloid protein in Bacillus physiology and fitness on the phylloplanebioRxiv - Microbiology 2019Quote: ... subtilis strains at the different time points were evaluated via terminal deoxynucleotidyl transferase (TdT) dUTP Nick-End Labeling (TUNEL) using the In-Situ Cell Death Detection Kit with fluorescein (Roche) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2020Quote: ... TUNEL staining was performed prior to secondary antibody incubation using the Biotin-based in situ cell death detection kit (Roche) and following the manufacturer instructions ...