Labshake search
Citations for Roche :
1651 - 1700 of 7633 citations for ssc mir 758 Real time RT PCR Detection Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2022Quote: ... The reactions were purified with the High Pure PCR product purification kit (Roche) and digested with SacI and XbaI enzymes in M buffer (TaKaRa) ...
-
bioRxiv - Cancer Biology 2019Quote: ... QRT-PCR reactions were carried out with a SYBR Green kit (Kapa Biosystems) on a CFX96 qRT-PCR machine (BioRad) ...
-
bioRxiv - Neuroscience 2020Quote: ... PCR amplifications were performed using the Absolute Blue SYBR green fluorescein kit (Roche Molecular Biochemicals ...
-
bioRxiv - Microbiology 2021Quote: ... The resulting amplicons were purified using High Pure PCR product purification kit (Roche) and shipped to Macrogen Europe B.V ...
-
bioRxiv - Microbiology 2019Quote: Bacterial DNA was extracted with a High Pure PCR Template Preparation kit (Roche Diagnostics Ltd ...
-
bioRxiv - Systems Biology 2022Quote: ... Linear DNA fragments were amplified using high-fidelity PCR kits from Kapa Biosystems sourced from Millipore Sigma (Burlington ...
-
bioRxiv - Neuroscience 2022Quote: ... sexed and genotyped (Kapa2G Robust HotStart PCR Kit, Kapa Biosystems; Hoffman La Roche) one week after birth ...
-
bioRxiv - Neuroscience 2022Quote: ... sexed and genotyped (Kapa2G Robust HotStart PCR Kit, Kapa Biosystems; Hoffman La Roche) one week after birth ...
-
bioRxiv - Genetics 2022Quote: ... Sperm DNA was extracted using the High Pure PCR Template Preparation Kit (Roche) modifying the first step of the protocol ...
-
bioRxiv - Bioengineering 2022Quote: ... subsequently indexed with Nextera adapter sequences using the KAPA2G Robust PCR Kit (Roche) and purified using the PureLink PCR Purification Kit ...
-
bioRxiv - Genomics 2019Quote: ... WGS libraries were prepared according to the KAPA HyperPrep PCR-free Kit (Roche). Illumina NovaSeq S2 150 bp paired-end sequencing was performed to achieve 40X genome coverage.
-
Biosynthesis of Circular RNA ciRS-7/CDR1as Is Mediated by Mammalian-Wide Interspersed Repeats (MIRs)bioRxiv - Molecular Biology 2019Quote: ... KAPA Taq PCR kit was used according to the manufacturer’s protocol (Kapa Biosystems).
-
bioRxiv - Genetics 2020Quote: ... or ear notch biopsies using the High Pure PCR Template Preparation Kit (Roche), KAPA Express Extract kit (Roche) ...
-
bioRxiv - Molecular Biology 2019Quote: ... and purified using a high pure PCR product purification kit (Roche, No. 11732668001). The DNA blots were prehybridized at 42°C for 1 h in DIG easy hyb granule and then hybridized to denatured DIG-labeled probes for 20 h ...
-
bioRxiv - Immunology 2020Quote: ... Site-directed mutagenesis was performed using the KAPA Hifi PCR kits (KAPA Biosystems).
-
bioRxiv - Microbiology 2021Quote: ... DNA sequencing libraries were prepared using the PCR-free KAPA HyperPrep Kit (Roche). Libraries were sequenced on an Illumina NextSeq 500 and the quality of the raw sequencing reads was analysed with FastQC (version 0.11.4 ...
-
bioRxiv - Molecular Biology 2022Quote: ... Library enrichment was performed with the KAPA HotStart PCR kit (Roche Diagnostics KK2502) in 50 μl of total reaction volume (10 μl 5X KAPA buffer ...
-
bioRxiv - Genomics 2022Quote: ... Libraries were constructed using the Kapa HIFI HotStart ReadyMix PCR Kit (KAPA Biosystems). Nucleic acid purification was performed using SPRI Select (BECKMAN COULTER) ...
-
bioRxiv - Molecular Biology 2022Quote: ... Purified cDNA was subjected to PCR amplification using KAPA Library Amplification Kits (Roche) with Forward Library primer (5’AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT3’ ...
-
bioRxiv - Molecular Biology 2022Quote: ... Genomic DNA was extracted with the High Pure PCR Template Preparation kit (Roche) from cells collected 72 hours after transfection.
-
bioRxiv - Microbiology 2023Quote: ... and PCR products were purified using the DNeasy blood and tissue kit (Roche), the High Pure Plasmid Isolation kit (Roche) ...
-
bioRxiv - Microbiology 2023Quote: ... We recircularized linearized plasmid PCR products with a Rapid DNA Ligation Kit (Roche) and transformed plasmids into DH5α-competent cells (Thermo Fisher) ...
-
bioRxiv - Cell Biology 2023Quote: ... genomic DNA was amplified using KAPA HiFi HotStart PCR kit (Kapa Biosystems, KK2501) according to the manufacturer’s guidelines and specific primers flanking the CRISPR cut site (with the CRISPR cut site off center ...
-
bioRxiv - Cancer Biology 2023Quote: ... DNA was purified using a High Pure PCR Template Preparation Kit (Roche, 11796828001) and q-PCR was performed as describe above ...
-
bioRxiv - Microbiology 2023Quote: ... PCR products were purified using the High Pure Purification Kit (Roche Applied Science). The oligonucleotides used to amplify and sequence the different hit-related genes are listed in Table S4.
-
bioRxiv - Evolutionary Biology 2023Quote: Long-range PCR was conducted using a KAPA LongRange HotStart Kit (KAPA Biosystems) in 25 µl volumes with 24 µl Master-mix (ultra-pure MilliQ water ...
-
bioRxiv - Molecular Biology 2024Quote: ... DNA was amplified using the 2X KAPA Taq ReadyMix PCR Kit (KAPA Biosystems, now Roche Sequencing ...
-
bioRxiv - Microbiology 2020Quote: ... PCR amplification of 16S rRNA genes was conducted using the KAPA2G™ Robust HotStart ReadyMix PCR Kit (Kapa Biosystems, Wilmington, MA, USA) in a total volume of 25 μl containing inner primer pairs (50 nM each ...
-
bioRxiv - Microbiology 2021Quote: ... PCR amplification of the 16S rRNA gene was performed using the KAPA2G™ Robust HotStart ReadyMix PCR Kit (Kapa Biosystems, MA, USA) with an inner primer pair (50 nM for each ...
-
bioRxiv - Plant Biology 2022Quote: ... The primers designated ‘forward’ (GCCTTTTCAGCAAGATGCCG) and ‘reverse’ (GTACTCCCTCCGCTCCAAAAT) were used to perform PCR amplifications with the Kapa HiFi HotStart PCR kit (Kapa Biosystems, Roche). The reactions were performed in a SimpliAmp Thermal Cycler (Applied Biosystems ...
-
bioRxiv - Microbiology 2019Quote: ... The V3-V4 region of the 16S rRNA gene was PCR amplified using the KAPA HotStart PCR Kit (Kapa Biosystems, Wilmington, MA) with 10 µL Kappa HotStart Mastermix ...
-
bioRxiv - Synthetic Biology 2020Quote: ... taiwanensis VLB120 was used as the template for the PCR and was isolated using the High Pure PCR Template Preparation Kit (Hoffmann-La-Roche, Basel, Switzerland). Plasmids were constructed by Gibson assembly using the NEBuilder Hifi DNA Assembly Master Mix (New England Biolabs ...
-
bioRxiv - Immunology 2021Quote: ... 5 μl of the resulting cDNA-containing reverse transcription mixes were then used as templates for 25 μL PCR reactions using the KAPA HiFi PCR kit with GC buffer (Roche Diagnostics, #07958846001) and the following thermal cycling conditions ...
-
bioRxiv - Microbiology 2022Quote: ... then guide sequences were amplified from gDNA and the plasmid pool by nested PCR using KAPA HIFI Hotstart PCR kit (Kapa Biosystems, KK2501), as previously described in (Young et al. ...
-
bioRxiv - Molecular Biology 2023Quote: ... the cDNA inserts of the plasmids were isolated and amplified by low-cycle (12x) PCR using a Kapa2G Robust Hotstart PCR kit (Roche, Ref #07961073001) according to specifications ...
-
bioRxiv - Microbiology 2023Quote: ... a 710 bp region was amplified by PCR using previously described primers (45) and the KAPA HiFi HotStart ReadyMix PCR Kit (Roche, Basel, Switzerland) following the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2019Quote: ... Probe labelling and detection of the blot were carried out using the DIG-DNA labelling mix and detection reagents (Anti-Digoxigenin-AP) (Roche) according to the manufacturer’s protocol ...
-
bioRxiv - Plant Biology 2020Quote: ... Real-time quantitative PCR assays were performed using the KOD SYBR® qPCR Mix (TOYOBO) on the Light Cycler 96 system (Roche Diagnostics, Germany). ΔCt method was used for estimating transcript abundance ...
-
bioRxiv - Immunology 2023Quote: ... and the second-strand cDNA was synthesized using a KAPA Biosystems kit (Roche KAPA HiFi Hotstart PCR kit, KK2502) with VHgene-specific primers (No ...
-
bioRxiv - Cancer Biology 2019Quote: Reverse transcription (RT) reactions were carried out using 1 μg of RNA using Transcriptor RT enzyme (Catalog No. 03531287001) from Roche Diagnostics ...
-
bioRxiv - Developmental Biology 2021Quote: ... on a Light Cycler 480 Detection System (Roche). The primers used for quantitative RT-PCR are listed in Table S2 ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... for detection in Light cycler LC 480 (Roche). All primers used for qRT-PCR are given in Table-2 ...
-
bioRxiv - Neuroscience 2022Quote: ... in a qPCR detection system (LightCycler LC480, Roche). The sequences are indicated in Table S2 ...
-
bioRxiv - Cell Biology 2023Quote: ... and a LightCycler® 480 Detection system (Roche), following manufacturer’s recommendations ...
-
bioRxiv - Microbiology 2023Quote: ... and the CDP-star detection system (Roche Diagnostics) as described previously [Commichau et al. ...
-
bioRxiv - Molecular Biology 2023Quote: ... For detection of in situ cell death (Roche), sections were processed for proteolytic digestion with proteinase K (Roche ...
-
bioRxiv - Genetics 2023Quote: ... Detection was performed using CSPD chemiluminescent substrate (Roche) on a ImageQuant LAS4000 ...
-
bioRxiv - Microbiology 2023Quote: ... and a LightCycler480 detection system (Roche, Mannheim, Germany). The relative expression of indicated genes was analyzed by the 2-ΔΔCt method ...
-
bioRxiv - Genomics 2019Quote: TUNEL staining on rat β-cells was performed 48h after transfection using the TMR red In Situ Cell Death Detection Kit (Roche) combined to polyclonal guinea pig anti-insulin (dilution 1:40 ...
-
bioRxiv - Cancer Biology 2021Quote: ... 5% CO2 by quantification of LDH released into cell supernatants by apoptotic/necrotic cells (LDH detection kit, Roche Applied Science, #11644793001). Maximal lysis of the target cells (= 100% ...