Labshake search
Citations for Roche :
1001 - 1050 of 3664 citations for hsa mir 635 RT PCR Primer Set since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2021Quote: ... Libraries were quantified using Kapa Illumina GA with Revised Primers-SYBR Fast Universal kit (Kapa Biosystems Inc.). Average size fragment was determined using a LabChip GX (PerkinElmer Inc. ...
-
bioRxiv - Molecular Biology 2019Quote: ... 1 μl of each forward and reverse primer (5 uM) and 10 μl SYBR green (Roche, 4707516001) were used for qPCR (30 sec at 98 °C and 19 cycles of 10 sec at 98 °C ...
-
bioRxiv - Developmental Biology 2019Quote: ... cDNA was combined with the primers listed below and with LightCycler® 480 SYBR Green I (Roche). Reactions were run in a LightCycler® 480 Multiwell Plate 384 machine (Roche) ...
-
bioRxiv - Molecular Biology 2019Quote: ... The Bar amplified fragment (Table 1) labeled by DIG high primer DNA labeling (Roche, Cat. No. 11585614910) and purified using a high pure PCR product purification kit (Roche ...
-
bioRxiv - Immunology 2021Quote: ... and cDNA was synthesized with primer oligo (dT) using Transcriptor High Fidelity cDNA Synthesis kit (Roche, SUI). PCR amplification was then performed using FastStrat High Fidelity PCR System (Roche ...
-
bioRxiv - Molecular Biology 2022Quote: ... Oligo-dT primer was used to synthesize cDNA by using Transcription First Strand cDNA synthesis kit (Roche) according to product user guide ...
-
bioRxiv - Cell Biology 2022Quote: ... and qPCR analysis was carried out using specific primer pairs and SYBR green master mix (Kapa Biosystems) with a QuantStudio 5 Real-Time PCR System (Thermo Fisher) ...
-
bioRxiv - Immunology 2023Quote: ... Purified DNA was then pre-amplified with indexed primers and HiFi HotStart Polymerase Ready Mix (KAPA Biosystems). After estimation of additional PCR cycles required110 ...
-
bioRxiv - Neuroscience 2023Quote: ... The cDNA was mixed with the primers of interest and with SYBR Green Master mix (Roche #04887352001) using the Bravo instrument (Agilent ...
-
bioRxiv - Immunology 2023Quote: ... The individual library pools were amplified using subpool specific primers and KAPA HiFi HotStart ReadyMix (Roche, #KK2601). After PCR ...
-
bioRxiv - Immunology 2021Quote: ... Quantitative reverse transcription PCR (qRT-PCR) was performed using an SYBR FAST universal qPCR kit (KAPA Biosystems). Predesigned KiCqStart primers for DDX58 ...
-
bioRxiv - Developmental Biology 2021Quote: ... Quantitative PCR (Q-PCR) reactions were performed using LightCycler FastStart DNA MasterPlus SYBR Green I kit (Roche). For each primer set ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... 2019) via 15 rounds of high-fidelity PCR amplification (KAPA HotStart PCR Kit, KAPA Biosystems, Wilmington, Massachusetts). Each pooled ...
-
bioRxiv - Cancer Biology 2019Quote: ... Quantitative real-time PCR was performed with the LightCycler® 480 Real-Time PCR System (Roche, Switzerland) and SYBR Premix Ex Taq (Takara) ...
-
bioRxiv - Cell Biology 2021Quote: ... and performed quantitative real-time PCR with the Light-Cycler 480 Real-Time PCR system (Roche, Switzerland). Relative gene expression of NPY ligands and receptors was performed under the assumption that the probes binding efficiency are equal ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: PCR was performed using the Roche High-Fidelity PCR System (Roche Life Science, Welwyn Garden City, UK). A total of 5ng DNA was amplified in a reaction volume of 10μl ...
-
bioRxiv - Cell Biology 2022Quote: ... Quantitative real-time PCR (qRT-PCR) was performed using KOD SYBR qPCR (TOYOBO) and LightCycler 96 (Roche). Target gene expression was normalized on the basis of Gapdh content.
-
bioRxiv - Neuroscience 2021Quote: ... Viral particles were quantified by real-time PCR Q-PCR using LightCycler480 SYBR Green I Master (Roche) and primers targeting the flanking sequence of ITR2 (GTAGATAAGTAGCATGGC and CTCCATCACTAGGGGTTCCTTG ...
-
bioRxiv - Genomics 2022Quote: Real-time quantitative reverse transcription PCR (qRT-PCR) was performed using KAPA SYBR FAST (Kapa Biosystems KK4610) on a 384-well LightCycler 480 Real-Time PCR System (Roche ...
-
bioRxiv - Cell Biology 2020Quote: ... Quantitative real-time PCR (qRT-PCR) was conducted using a LightCycler® 96 Instrument (Roche Molecular Systems) and qRT-PCR reaction was performed with KAPA SYBR FAST qPCR kit (KAPA Biosystems) ...
-
bioRxiv - Microbiology 2021Quote: ... PCR reaction mixtures consisted of 10 μL of KAPA HiFi HotStart ReadyMix 2X PCR Kit (Kapa Biosystems), 0.3 μM forward primer ...
-
bioRxiv - Genetics 2020Quote: Exon 3 of the MSH2 gene was PCR amplified using the Expand High Fidelity PCR kit (Roche) with the following conditions ...
-
bioRxiv - Pathology 2021Quote: Real-time quantitative PCR was performed using KAPA PROBE FAST Universal One-Step qRT-PCR (Roche, Switzerland) and a specific pair of primers and a probe for amplification and detection of ToBRFV (Table S1) ...
-
Characterization of a novel Fgf10CreERT2 knock-in mouse line targeting postnatal lung Fgf10 lineagesbioRxiv - Developmental Biology 2021Quote: ... Quantitative real-time PCR (qPCR) was performed using LightCycler 480 real-time PCR machine (Roche Applied Science). Samples were run in doublets using B2M as a reference gene and the DDCT method was used to calculate the relative quantification ...
-
bioRxiv - Cell Biology 2021Quote: ... The qRT-PCR analyses were performed on a Roche 480 real-time PCR system (Roche, Mannheim, Germany). The RNA levels were calculated as described by Livak and Schmittgen (2001) ...
-
bioRxiv - Molecular Biology 2022Quote: ... The resulting DNA products were amplified by inverse PCR using the Expand Long Template PCR system (Roche) with primers designed within the Six2 promoter ...
-
bioRxiv - Plant Biology 2022Quote: Gene expression was determined by quantitative real-time PCR (qRT-PCR; LightCycler 480, Roche Diagnostics, Rotkreuz, Switzerland) using SYBR Premix Ex Taq™ (TaKaRa ...
-
bioRxiv - Pathology 2023Quote: ... Quantitative Real-Time PCR (qRT-PCR) was done using the LightCycler® 480 Instrument (Roche Applied Science) with FastStart Essential DNA Green Master Mix (Roche Life Science) ...
-
bioRxiv - Immunology 2023Quote: ... qRT-PCR reactions were performed on a LightCycler 96 Real-Time PCR System (Roche Diagnostics, Indianapolis, IN). The reaction mixture was activated at 50°C for 2 min ...
-
bioRxiv - Genomics 2023Quote: Real-time quantitative reverse transcription PCR (qRT-PCR) was performed using KAPA SYBR FAST (Kapa Biosystems KK4610) on a 384-well LightCycler 480 Real-Time PCR System (Roche ...
-
bioRxiv - Cell Biology 2023Quote: SA2 cDNAs were cloned directly from HCT116 cells by PCR using KAPA HiFi HotStart PCR kit (Roche) (Fwd ...
-
bioRxiv - Genetics 2023Quote: ... PCR for HRM analysis was performed by using a KAPA HRM Fast PCR Kit (Roche, Basel, Switzerland) on a LightCycler 96 System (Roche ...
-
bioRxiv - Microbiology 2023Quote: ... The first targeted PCR was performed using a KAPA HiFi HotStart ReadyMix PCR Kit (Roche, Basel, Switzerland). Thermal cycles were as follows ...
-
bioRxiv - Biochemistry 2024Quote: ... The real-time PCR was conducted on a real-time fluorescence quantitative PCR equipment (light-Cycler480II, Roche) according to the protocol of SYBR Green qPCR Mix (Dongsheng Biotech ...
-
bioRxiv - Genetics 2023Quote: ... PCR Amplification was performed with KAPA HiFi HotStart PCR Kit (Kapa Biosystems, Wilmington, MA; catalog no. KK2501) in 25 µL reactions containing 5X KAPA HiFi Buffer - 5 µL ...
-
bioRxiv - Microbiology 2023Quote: Nucleic acids wash and immunological detection of the DIG-labeled probes were performed using the DIG Wash and Block Buffer Set (Roche, Cat No. 11585762001) according to the manufacturer’s protocols ...
-
bioRxiv - Cancer Biology 2023Quote: ... We determined the size of the final library construct on the Caliper LabChip GX system and quantified it using qPCR SYBR Green reactions with a set of DNA standards and the Kapa Library Quantification Kit (KAPA Biosystems, Part#KK4854). Size and concentration values were entered into the WikiLIMS database for the sequencing team’s use for appropriate flow-cell loading ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... RT-qPCR reactions were performed on 10 ng cDNA using LightCycler 480 SYBR Green Master Mix (Roche) with 10 ul reaction volumes ...
-
bioRxiv - Microbiology 2020Quote: ... RT-qPCR reaction was performed in a Roche Lightcycler using FastStart Essential DNA Probes Master mix (Roche) and gene specific primer/probe sets (Table 1 ...
-
bioRxiv - Genomics 2022Quote: ... RT-qPCR was performed using a LightCycler 96 and the SYBR green master mix (Roche, Solna, Sweden). Gene expression levels were normalized to the AT5G09810 and AT5G25760 reference genes and displayed in relative units ...
-
bioRxiv - Plant Biology 2020Quote: ... RT-qPCR amplifications were performed from 10 ng of cDNA using SYBR Green I master mix (Roche) in 96-well plates according to the manufacturer’s recommendations ...
-
bioRxiv - Physiology 2019Quote: ... at RT followed by incubation with mouse anti-DIG alkaline phosphatase (AP) antibody (1:2000) (#11093274910, Roche) in Roche blockingbuffer (1:10 in PBT ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... One thousand ng of total RNA was used for retro-transcription (RT) (Expand™ Reverse Transcriptase, Roche). In the case of mixed infections ...
-
bioRxiv - Cell Biology 2020Quote: ... RT-qPCR to assess for mRNA relative expression was performed with SYBR green master mix (Roche, 04913914001) in Applied biosciences machine ...
-
bioRxiv - Immunology 2022Quote: ... and incubated for 1 hour at RT with the secondary antibodies together with DAPI (1:5,000; Roche), all diluted in Dako Antibody Diluent ...
-
bioRxiv - Developmental Biology 2023Quote: ... R-5’-GGGACGCAGCAACTGACATT-3’) was assessed by RT-qPCR using SyBR Green solution on a LightCycler480 (Roche). The cDNAs of every single cell were purified using the DNA Clean & Concentrator Kit (Zymo ...
-
bioRxiv - Genomics 2022Quote: ... 100 ng of RNA was used for reverse transcription (RT) using Transcriptor universal cDNA master mix (Roche) for Min6 cells or superscript III enzyme (Invitrogen ...
-
bioRxiv - Physiology 2023Quote: ... real-time RT-qPCR was performed using the Lightcycler® 480 II system (Roche Diagnostics, Basel, Switzerland) with primers designed based on (i ...
-
bioRxiv - Microbiology 2023Quote: ... RT–qPCR was performed on a LightCycler 480 system using LightCycler SYBR Green I Master (Roche Diagnostics). The primers were designed with the software Primer 3 ...
-
bioRxiv - Developmental Biology 2019Quote: ... Products were amplified in a real-time PCR reaction with Light Cycler 480 Real-Time PCR System (Roche) using a UPL Probes Master mix (Roche ...