Labshake search
Citations for Roche :
6751 - 6800 of 8217 citations for 2 1 ethylpentyl 1 3 dioxan 5 yl laurate since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2020Quote: ... consisting of MS1 with 300 mg/L carbenicillin and 5 mg/L hygromycin (Roche, Germany) (YFT1-CDS) ...
-
bioRxiv - Microbiology 2020Quote: ... qPCR reactions were prepared using 5 μL of FastStart SYBR Green Master mix (Roche Diagnostics) with a final concentration of 1μM of each primer ...
-
bioRxiv - Immunology 2020Quote: ... membranes were blocked in 5% BSA (BSA Fraction V; Roche Life Sciences, Almere, The Netherlands) in TBS-T or 5% milk in TBS-T for 1 h ...
-
bioRxiv - Microbiology 2022Quote: ... Membranes were blocked in 5% milk and probed with 3F10-HRP anti-HA antibody (Roche) followed by imaging with ECL.
-
bioRxiv - Cell Biology 2021Quote: ... followed by PCR amplification with EcoRI-CEP131-5’ (ACCGAGAATTCCATGAAAGGCACCCGGGC) using KAPA HiFi DNA polymerase (Roche). The product was digested with EcoRI and BamHI and ligated into similarly digested pEGFP-C1 (Clontech) ...
-
bioRxiv - Immunology 2020Quote: Data on miRNA expression were obtained from the FANTOM5 dataset (https://fantom.gsc.riken.jp/5/suppl/De_Rie_et_al_2017/vis_viewer/#/human) and from (18) (Cohort Roche, GEO accession: GSE28492). The FANTOM5 dataset was downloaded and analyzed using Qlucore Omics Explorer software ...
-
bioRxiv - Cancer Biology 2022Quote: ... Samples were then blocked in PBT 0.2% with 5% bovine serum albumin (Roche, Cat# 10735094001) before staining with primary antibodies overnight at 4 °C ...
-
bioRxiv - Physiology 2022Quote: ... 5 μL KAPA SYBR® FAST Master Mix (2X) Universal (Kapa Biosystems Inc., MA, USA), and 100 nM of gene-specific primers ...
-
bioRxiv - Plant Biology 2022Quote: ... and immunoprecipitated with 5 μg Mouse monoclonal anti-GFP antibody (clone 9E10, IgG, Roche, Switzerland). About 200∼300 bp of ChIP DNA and input DNA were recovered and dissolved in water for further qPCR analysis [82] ...
-
bioRxiv - Plant Biology 2022Quote: ... The 5’-end biotin probes were generated using a DIG Gel Shift Kit (Roche, China) (Supplemental Table S8) ...
-
bioRxiv - Molecular Biology 2023Quote: ... 5 mM EDTA pH 8.0) supplemented with protease inhibitors (cOmplete Protease Inhibitor Cocktail, Roche, 11697498001) and lysed by vortexing at 4 °C for 15 minutes.™ Cell debris was pelleted by spinning at 21000 RCF at 4 °C for 15 minutes and protein containing supernatant was taken ...
-
bioRxiv - Molecular Biology 2023Quote: ... 5×106 K562 cells were resuspended in PBS with EDTA-free protease inhibitor cocktail (Roche) and lysed using a 27.5G needle ...
-
bioRxiv - Microbiology 2022Quote: ... 5 mM MgCl2 and 0.25 M sucrose) supplemented with a protease inhibitor cocktail tablet (Roche). Successively ...
-
bioRxiv - Physiology 2023Quote: ... Worms were homogenized in PBS containing 5% TritonX-100 and a protease inhibitor cocktail (Roche), and lipid was extracted using the TissueLyser II (QIAGEN ...
-
bioRxiv - Neuroscience 2023Quote: ... and 0.2 μl (5 U/μl) FastStar Taq DNA Polymerase (Roche Diagnostics GmbH, Mannheim, Germany) in a total volume of 25 μl ...
-
bioRxiv - Cancer Biology 2023Quote: ... fibronectin-coated (5 μg/cm2 coating the outer part of the membrane, Roche, cat#11080938001) inserts in 24-well plates (Corning-Falcon cat# 353097) ...
-
bioRxiv - Molecular Biology 2023Quote: ... plasmid DNA containing EEEb1 was labeled with cyanine-5-dUTP by Nick Translation Mix (Roche), while plasmid DNA harboring each of the other nine DNA families (EEEb2–EEEb10 ...
-
bioRxiv - Developmental Biology 2023Quote: ... rehydrated in PBST and bleached in formamide bleaching solution (4 hours) (5% formamide - Roche 11814320001), and 1.2% hydrogen peroxide (Sigma H1009) ...
-
bioRxiv - Cancer Biology 2023Quote: ... Media was aspirated and minced tissue was digested with ∼5 mg of Collagenase P (Roche) in 5 mL cold HBSS for 15-20 minutes ...
-
bioRxiv - Neuroscience 2024Quote: Adenosine 5’-triphosphate (ATP) levels were assessed using an ATP Bioluminescence assay Kit (Sigma/Roche). Briefly ...
-
bioRxiv - Biophysics 2024Quote: ... 5% (v/v) Glycerol and EDTA-free protease inhibitor cocktail tablet/50 ml (Roche, UK)] ...
-
bioRxiv - Plant Biology 2024Quote: ... 5 µL PCR grade water and 12.5 µL KAPA HiFi HotStart ReadyMix (Roche, Indianapolis, USA). Samples were normalized and pooled in equimolar amounts and the pools were sequenced on the Illumina MiSeq machine with the 2 x 300 bp V3 kit at the USEQ sequencing facility (Utrecht University ...
-
bioRxiv - Plant Biology 2024Quote: ... 5 µL PCR grade water and 12.5 µL KAPA HiFi HotStart ReadyMix (Roche, Indianapolis, USA). The PCR conditions were 98°C for 5 min ...
-
bioRxiv - Genetics 2024Quote: ... snRNA-seq 5’ libraries were balanced using a Kapa library quantification kit (Roche, Indianapolis, IN) and pooled to generate 150 base pair ...
-
bioRxiv - Systems Biology 2024Quote: ... see Supplemental Table 5) for 8 cycles with 2X KAPA HiFi master mix (Roche, 07958935001). Double stranded oligo cleanup and library cloning was performed as described above for the RPE-1 essentials library.
-
bioRxiv - Cancer Biology 2024Quote: ... 5-plex immunohistofluorescent staining was performed on the fully automated Ventana Discovery Ultra (Roche Diagnostics) using the manufacturer’s solutions and antibodies ...
-
bioRxiv - Molecular Biology 2024Quote: ... or mutant Piwi6 were transfected using 5 μL X-tremeGENE HP DNA Transfection Reagent (Roche) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2021Quote: ... Plates were developed by discarding 100 ul from each well and adding 100 ul of solution containing DMEM with 10% FBS and WST-1 reagent (Roche Diagnostics) diluted 1:10 ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... 3 μL of each primer at 10 μM and 0.5 μL of 1 U/μL Kapa HiFi HotStart DNA polymerase (Kapa Biosystems, Inc, A Roche Company) for a total volume of 25 μL ...
-
bioRxiv - Cancer Biology 2021Quote: ... For CO-IP MS analysis JJN-3 KO and WT cells were incubated in hypoxia for 24 hours before lysis with 4x pellet volume RIPA buffer (1% CHAPS, 50 mM Tris, 150 mM NaCl, Complete protease inhibitor (Roche Diagnostics) and phosphatase inhibitor cocktails 2 and 3 (Sigma-Aldrich) ...
-
bioRxiv - Cell Biology 2020Quote: ... 1μg of this material was then ligated in a volume of 20 μl with 1 μl of T4 DNA ligase (Roche, 10799009001) at 16°C to generate a randomized library of large fragments ...
-
bioRxiv - Immunology 2021Quote: Single-cell suspensions of tumors were generated by dicing tumors with a razor blade followed by enzymatic digestion for 30 minutes at 37C in medium containing 1 mg/mL Collagenase D (Roche Diagnostics) and 1μg/mL DNase I (ThermoFisher Scientific) ...
-
bioRxiv - Neuroscience 2021Quote: ... Pooled tissue from each brain region was suspended in 6 ml of 0.32 M sucrose homogenization buffer (4 mM HEPES, 0.1 mM CaCl2, 1 mM MgCl2, plus Roche protease inhibitor tablet) and homogenized with a Teflon homogenizer using 10 strokes at 900 rpm ...
-
bioRxiv - Developmental Biology 2022Quote: ... cDNA was synthesized from 1 μg total RNA for each sample using the Transcriptor High Fidelity cDNA Synthesis Kit (Roche, 05081963001), with a mixture of oligo dT and random primers ...
-
bioRxiv - Genomics 2020Quote: ... This was followed with primary antibody incubation performed with 1:1000 goat anti-SOX17 (R&D) diluted with Antibody Dilution Buffer (Roche Ventana) for 60 minutes at 37°C ...
-
bioRxiv - Genetics 2020Quote: ... and the cDNA was diluted 1/10 for qPCRs using MESA BLUE MasterMix (Eurogenentec, 10-SY2X-03+NRWOUB) on a LightCycler® 480 Instrument II (Roche). A list of primers used can be found in Supplementary Table 7.
-
bioRxiv - Biochemistry 2020Quote: ... Blots were re-probed to detect ZMPSTE24 and Rce1 using rat anti-HA (clone 3F10, Roche cat #11867423001; 1:10000 dilution), and polyclonal rabbit anti-Rce1 [52] (1:2000 dilution) ...
-
bioRxiv - Immunology 2021Quote: ... 1mM PMSF, 1% NP-40, 0.5% sodium deoxycholate, 0.1% SDS, 1x Roche Complete Protease Inhibitor Cocktail, and 1x Roche Phosphatase Inhibitor Cocktail). Protein concentrations were measured using a BCA kit (Pierce) ...
-
bioRxiv - Biochemistry 2020Quote: ... 150 mM NaCl and 1 mM DTT and incubated at RT in 0.05 mg/mL sequencing grade trypsin (Roche Applied Science). Digestions were stopped with 2X Laemmli sample buffer and placed on ice until analysis ...
-
bioRxiv - Neuroscience 2021Quote: ... for 2 hours at room temperature and left to incubate for 24 hours with blocking buffer containing a 1:200 dilution of anti-DIG (Roche, 11207733910) or anti-fluorescein antibody conjugated with POD (Roche ...
-
bioRxiv - Neuroscience 2020Quote: All qPCR reactions were performed in 10 μl volume in triplicates with 1× HOT FIREpol EvaGreen qPCR Mix Plus (Solis Biodyne) and primers listed in Supplementary Table 1 on LightCycler® 480 PCR instrument II (Roche). Gene expression levels were normalized to HPRT1 mRNA levels in neurons and Cyclophilin B mRNA levels in astrocytes ...
-
bioRxiv - Plant Biology 2021Quote: ... 150mM NaCl] supplemented with 1% Tween® 20 for 30 min before probing the membrane with either rat monoclonal anti-HA antibody (3F10, Roche) or mouse monoclonal ANTI-FLAG® antibody conjugated to HRP (M2 ...
-
bioRxiv - Plant Biology 2020Quote: ... transferred to a PVDF membrane and immunoblotted with rat monoclonal anti-HA (High Affinity, clone 3F10, Roche, www.roche.com; 1:2000 dilution) and hybridized with peroxidase conjugated goat anti-rat (Polyclonal ...
-
bioRxiv - Microbiology 2021Quote: ... HindIII treatment was performed at 37°C for 1 h in 1x reaction buffer B with 10U of HindIII enzyme per reaction (HindIII, 10656321001, Roche, Switzerland). Mung bean nuclease treatment was performed at 30°C for 30 min in 1x mung bean nuclease reaction buffer with 1U per reaction (Mung Bean Nuclease ...
-
bioRxiv - Plant Biology 2021Quote: ... The digested DNA was separated in a 1 % agarose gel at 50 Volts for 72 hours at 4°C and transferred to a nylon membrane (Roche®) overnight ...
-
bioRxiv - Cell Biology 2021Quote: Transduced MEFs were seeded in triplicate in a 96 well flat bottom tissue culture plate and WST-1 assay (Roche, Switzerland) performed as per manufacturer’s protocol at day 0 ...
-
bioRxiv - Cell Biology 2022Quote: 3T3-L1 adipocytes were washed with ice-cold PBS and harvested in ice-cold HES-I buffer (20 mM HEPES, pH 7.4, 1 mM EDTA, 250 mM sucrose containing protease inhibitors mixture (Roche Applied Science)) ...
-
bioRxiv - Molecular Biology 2022Quote: ... synovial tissues from three patients with RA were minced and incubated with 1 mg/mL collagenase/dispase (Roche, Indianapolis, IN, USA) in phosphate-buffered saline (pH7.2 ...
-
bioRxiv - Molecular Biology 2022Quote: ... Biotin-labeled LPA1-HA was detected using streptavidin beads (Pierce) and conjugated anti-HA antibody (3F10 from Roche Diagnostics; 1:1000).
-
bioRxiv - Biophysics 2022Quote: ... embryos were washed (4 X 10 min) in PBTx and blocked in PBT-B (1× PBS, 20% (v/v) western blocking reagent (Roche, 11921673001), 2 mM ribonucleoside vanadyl complex (NEB ...