Labshake search
Citations for Roche :
6701 - 6750 of 7401 citations for 3 1 3 Dioxan 2 yl 3' methoxypropiophenone since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2021Quote: ... 1 µg of total RNA was then reverse-transcribed to cDNA using the iScript cDNA synthesis kit (Biorad; #1708891) (Roche). Diluted cDNAs (1:5 ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... 0.1% SDS and 1%Triton X-100 and protease inhibitors cocktail (Mini-Complete EDTA-free; Roche Applied Science, Penzberg, Germany). Lysates were centrifuged (13000g ...
-
bioRxiv - Neuroscience 2021Quote: Dissected brain regions of interest or culture samples were homogenized with TX-soluble buffer (50 mM Tris [pH 8.0], 150 mM NaCl, 1% Triton-X 100) containing protease and phosphatase inhibitors (Roche, USA). The supernatants were collected for soluble fraction after centrifugation (20 ...
-
bioRxiv - Biochemistry 2021Quote: Cells confluent in a 15-cm dish were washed by PBS buffer three times before being lysed on plate with 1 mL ice-cold NP-40 lysis buffer supplemented with protease inhibitor cocktail (Roche) and PhosSTOP (Roche) ...
-
bioRxiv - Cancer Biology 2020Quote: ... minced with a sterile scalpel in a petri-dish containing complete medium (DMEM/10%FBS/2mM L-Glutamine/1x NEAA/1x Sodium Bicarbonate/10mM HEPES/ 1x Pen/Strep) and then incubated with complete medium containing 1 mg/ml Collagenase P (Roche) for 90 minutes at 37°C ...
-
bioRxiv - Genetics 2021Quote: ... The cultures were spun down and cell pellets were resuspended in 500 μL of Workman Extract Buffer (40mM HEPEs pH7.4, 250mM NaCl, 0.1% NP40, 10% Glycerol, 1 mM PMSF, Roche proteinase inhibitors). 250 μL of glass beads were added and cells were lysed with Peqlab precellys homogenizator (3×30 sec) ...
-
bioRxiv - Cancer Biology 2021Quote: ... They were incubated 1h at RT in a blocking buffer (20% Blocking reagent + 20% Goat serum) and then overnight with an anti-DIG-AP antibody (1:2000, Roche) in the blocking buffer ...
-
bioRxiv - Immunology 2020Quote: ... Bacterial pellets obtained by centrifugation at 13,500g for 10 min at 4°C were resuspended in 1 ml of PBS containing protease inhibitors (cOmplete Mini, Roche; 1 tablet per 10 ml of PBS following the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2020Quote: ... digested using 0.1 % papain at 37°C for 10 min and for 5 additional minutes in presence of DNAse1 (1 mg/ml, Roche). After stopping papain activity by adding MC+ media ...
-
bioRxiv - Microbiology 2021Quote: ... Radiolabeled probe was generated by purifying a digested (Ncol; 1 cut) pCpG vector DNA using High Pure PCR product Purification Kit (Roche) followed by radiolabeling the probe using Random Prime DNA labeling kit (Roche) ...
-
bioRxiv - Microbiology 2020Quote: ... coli cells were resuspended in 200 mL of cold Lysis buffer (50 mM HEPES pH 8, 300 mM NaCl, 1 mM EDTA, 5 % glycerol, 4 tablets of protease inhibitors, Roche). The cells were lysed and the membrane fraction was collected as described in the YukC purification protocol below ...
-
bioRxiv - Developmental Biology 2020Quote: ... samples were incubated overnight at 4°C with an anti-DIG-AP antibody (Roche, diluted 1:2000 in blocking solution). The next day ...
-
bioRxiv - Molecular Biology 2020Quote: Cells were lysed using the same lysis buffer as used for the ribosome profiling experiment with 1× protease inhibitor cocktail (Roche), omitting cycloheximide ...
-
bioRxiv - Immunology 2020Quote: ... was amplified from cDNA using primers mPodoHindFor (GATCAAGCTTATGTGGACCGTGCCAGTGTTG) and mPodoFcRev (GATCGGATCCACTTACCTGTCAGGGTGACTACTGGCAAGCC) and was quantified by SYBR Green 1 mastermix (Roche) qPCR using a PCR thermocycler and normalised to unstimulated control.
-
bioRxiv - Immunology 2020Quote: ... were cut into small pieces with a scalpel and incubated in a Collagenase D (1 mg/ml)/ of DNase I (70 μg/ml) enzymatic cocktail (Roche) in RPMI ...
-
bioRxiv - Immunology 2020Quote: ... mouse thymus was collected and homogenized in 1 ml of cold PBS containing cOmplete protease inhibitor cocktail (Roche, Indianapolis, IN) using a tissue homogenizer (Omni International ...
-
bioRxiv - Immunology 2020Quote: ... The mucosa was stripped and dissociated in GentleMACS tubes in digestion medium (DM; complete medium (RPMI 1640 with PGA/L-glutamine/10% FCS) with 1 mg/mL Collagenase D (Roche), 1 mg/mL soybean Trypsin inhibitor (Sigma) ...
-
bioRxiv - Molecular Biology 2020Quote: ... and protein extracted using RIPA buffer with protease inhibitor cocktail mix (1 Complete MINI EDTA-free protease inhibitor tablet (Roche), 25 μg/mL calpain inhibitor (Sigma) ...
-
bioRxiv - Molecular Biology 2021Quote: ... gel pieces briefly rinsed with 50 mM AmBic and rehydrated in a small volume (10 μL) of 50 mM AmBic supplemented with 1 U PNGase F (Roche) at 37 °C for 30 min ...
-
bioRxiv - Immunology 2021Quote: ... LNs were sliced into small pieces and digested for 30 min at 37°C in collagenase D (1 mg/ml, Roche). For DC-T conjugate analysis by flow cytometry and ImageStream ...
-
bioRxiv - Neuroscience 2021Quote: ... blocked with blocking solution for 1 hour and finally incubated overnight at 4°C with anti-Fluorescein-POD antibody (Roche) diluted 1:500 in blocking solution ...
-
bioRxiv - Cancer Biology 2020Quote: ... 50 mM NaCl, 50 mM sodium pyrophosphate, 50 mM sodium fluoride, 1% Triton-X-100, 10% glycerol, 5 mM EDTA, Roche MiniProtease Inhibitor cocktail tablet ...
-
bioRxiv - Neuroscience 2022Quote: ... and proteins were transferred to an activated (100% ethanol, 1 min; followed by two washing steps with water) PVDF membrane (Roche Diagnostics GmbH ...
-
bioRxiv - Molecular Biology 2022Quote: ... 1 mM TCEP 10 % v/v glycerol) supplemented with 4x EDTA-free protease inhibitor cocktail tablets (Roche, cat. No. 11836153001) and 4 μg/ml DNase I ...
-
bioRxiv - Developmental Biology 2022Quote: ... before being incubated in TNTw/block for 1 hour followed by an ON incubation with anti-DIG or anti-Fluo horseradish peroxidase (Roche). Post-antibody washes and the TSA reactions were repeated as for the first probe ...
-
bioRxiv - Cell Biology 2022Quote: ... Thawed pellets were resuspended with 200-300 µL native lysate buffer (1% NP-40 with 1X cOmplete protease inhibitor cocktail [SKU, 11836145001, Roche] ...
-
bioRxiv - Cell Biology 2022Quote: ... At the completion of the assay islets were lysed in RIPA buffer (Pierce) containing 1 mM PMSF and EDTA-free protease inhibitor cocktail (Roche)) at 95°C for 5 minutes ...
-
bioRxiv - Cell Biology 2022Quote: Protein lysates were collected from worms using RIPA buffer (50 mM Tris-HCl, 250 mM sucrose, 1 mM EDTA, and Roche protease inhibitor tablet ...
-
bioRxiv - Biophysics 2022Quote: ... cells were gently washed twice with 500 μl cold PBS and directly lysed in 50 μl of lysis buffer (PBS, 1% (v/v) Triton X-100 and protease inhibitor cocktail (Roche)) ...
-
bioRxiv - Cancer Biology 2022Quote: ... at 1:500 for 32 min was used followed with the secondary antibody OmniMap anti-rabbit HRP (760-4311, Roche). Antigen-antibody complexes were revealed with ChromoMap DAB Kit (Roche ...
-
bioRxiv - Biochemistry 2022Quote: ... 150 ng of U1 RNA (TMG or NAD cap) and 150 ng of HIV-1 mRNA were mixed with ResoLight dye (1x, Roche) and annealing buffer (10 mM Tris ...
-
bioRxiv - Molecular Biology 2022Quote: Mouse pancreata from adult mice (9-14 week old) were perfused with a solution containing 1 mg/mL collagenase-P (Roche) in Hank’s buffered salt solution (HBSS ...
-
bioRxiv - Cancer Biology 2022Quote: ... The eluted chromatin was then treated with RNaseA (10mg/mL) for 1 hour at 37°C and with Proteinase K (Roche) for 2 hours at 55°C ...
-
bioRxiv - Cell Biology 2022Quote: ... Both Caco2 and HepG2 cells were transfected with 1 µg of pooled plasmid using X-tremeGENE9 Transfection Reagent (Roche:6365779001) following manufacturer recommendations ...
-
bioRxiv - Cell Biology 2022Quote: ... isolated from each cell line was collected by centrifugation (30 000 x g, 4°C, 10 min) and resuspend in 1 x PBS supplemented with protease inhibitors (Roche) to protein concentration 1.5 mg/ml ...
-
bioRxiv - Developmental Biology 2022Quote: LC-MS-based quantification of methyl-cytosines was performed on 1 μg of DNA degraded to nucleosides with nuclease P1 (Roche), snake venom phosphodiesterase (Worthington ...
-
bioRxiv - Genetics 2022Quote: ... 50000 cells were lysed in NPB buffer (PBS containing 5% BSA, 1mM DTT, 0.2% IGEPAL, 1□×_Roche Complete Protease Inhibitor) and incubated on ice for 15 min to isolate nuclei ...
-
bioRxiv - Genetics 2022Quote: ... COS-7 cells transiently expressing POPDC constructs with the appropriate epitope tag were lysed using a 1% (v/v) Triton X-100 based lysis buffer supplemented with cOmplete protease inhibitor cocktail (Roche). Lysates were subjected to Co-IP using the ProFoundTM c-Myc Tag IP/co-IP Kit (Thermo Scientific ...
-
bioRxiv - Evolutionary Biology 2022Quote: Slides were blocked for two hours at room temperature in blocking buffer composed of 1% Roche blocking reagent (Roche #11096176001) and 20% sheep serum ...
-
bioRxiv - Developmental Biology 2022Quote: ... and 0.25 µM forward and reverse primers (Extended Data Table 1) on a LightCycler 480/II 384 (Roche, serial #6073). Four technical replicates were performed per biological replicate qPCR primer set ...
-
bioRxiv - Microbiology 2022Quote: ... lacking the predicted signal peptide (amino acids 1-29) was amplified from genomic DNA (isolated using the High Pure Template kit, Roche) by PCR using the Phusion Hot start II High Fidelity DNA Polymerase (Thermo Fisher Scientific ...
-
bioRxiv - Physiology 2022Quote: ... Sections after the post-hybridization washing and blocking steps were incubated with peroxidase-conjugated anti-digoxigenin sheep antibody (1:1000; 11207733910, Roche) in TS 7.5 containing 1% Blocking Reagent at 4°C for overnight ...
-
bioRxiv - Molecular Biology 2022Quote: ... were co-transfected with SAE2-T2A-SAE1 cDNA in the pcDNA5/FRT/TO vector and the Flp-recombinase cDNA in the pOG44 vector at a 5:1 pcDNA5/FRT/TO DNA: pOGG44 DNA ratio using FuGene6 (Roche) at a ratio of 4:1 FuGene (μl) ...
-
bioRxiv - Microbiology 2022Quote: ... Beads were then washed three times with 400 μL wash buffer (25 mM Tris-HCl pH 8, 150 mM NaCl, 1 mM EDTA pH 8, cOmplete protease inhibitor cocktail (Roche), 5% glycerol) ...
-
bioRxiv - Microbiology 2022Quote: ... A cell pellet was resuspended in 250 μL Tris-EDTA buffer and 50 μL 30 g L-1 lysozyme (Roche) in Tris-EDTA buffer ...
-
bioRxiv - Molecular Biology 2022Quote: ... 30 mM imidazole and 10 % (v/v) glycerol] supplemented with 1 mM PMSF and complete EDTA-free protease inhibitor cocktail (Roche). After centrifugation at 45 000 x g supernatant was filtered (0.45 µm ...
-
bioRxiv - Plant Biology 2022Quote: ... 10% [v/v] glycerol, 10 mM EDTA, 1% [v/v] NP-40, and complete EDTA-free protease inhibitor cocktail [Roche]). The extracts were centrifuged at 20,000 × g at 4°C for 15 min ...
-
bioRxiv - Plant Biology 2022Quote: ... then ground in 500 μl freshly prepared lysis buffer (25 mM Tris HCl pH 8, 150 mM NaCl, 1% SDS, 1x cOmplete ULTRA protease inhibitor (Roche), and 1x PhosSTOP (Roche)) ...
-
bioRxiv - Biochemistry 2022Quote: ... Cells were incubated with 8-keto-NeuAc derivatives for 24 h and proliferation measured using WST-1 (Roche Applied Science) according to manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2023Quote: ... 1 μg of total RNA from each sample was converted into cDNA with First Strand cDNA Synthesis Kit (Roche, #04897030001). Primers used in the RT-qPCR are listed in Supplementary Table S1 ...