Labshake search
Citations for Roche :
5401 - 5450 of 5547 citations for Parallel Artificial Membrane Permeability Assay PAMPA Kit since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2023Quote: ... 5 µl RNA eluate was used in a RVFV RT-qPCR using the LightCycler one-tube RNA Amplification Kit HybProbe (Roche, Almere, The Netherlands) in combination with a LightCycler 480 real-time PCR system (Roche ...
-
bioRxiv - Pathology 2023Quote: ... was performed with RNAscope® 2.5 VS Reagent Kit (323250, Advanced Cell Diagnostics, Newark, CA) on a Ventana Discovery Ultra platform (Roche Diagnostics, Penzberg, Germany). Sections were exposed to 24 hours antigen retrieval and 16 min protease treatment ...
-
bioRxiv - Plant Biology 2023Quote: ... and purified based on the manufacturer’s instructions before sample barcoding with xGen Stubby Adapter and Unique Dual Index Primers (IDT) and library preparation using KAPA HyperPrep Kit (Kapa Biosystems-Roche, Wilmington, MA). The library was then sequenced by Illumina MiSeq nano PE150 at the Georgia Genomics and Bioinformatics Core ...
-
bioRxiv - Genetics 2023Quote: ... RNA sequencing libraries were prepared as described previously (Ma, Fuqua et al. 2019) using the KAPA Stranded mRNA-Seq Kit (cat #KK8421, KAPA Biosystems, Wilmington, MA). The pooled libraries were sequenced in an Illumina HiSeq4000 instrument (Illumina ...
-
bioRxiv - Cancer Biology 2023Quote: Libraries were prepared by the Van Andel Institute Genomics Core from 500 ng of total RNA using the KAPA mRNA Hyperprep kit (v4.17) (Kapa Biosystems, Wilmington, MA USA). RNA was sheared to 300-400 bp ...
-
bioRxiv - Cancer Biology 2023Quote: ... The cDNA libraries were quantitated using qPCR in a Roche LightCycler 480 with the Kapa Biosystems kit for Illumina library quantitation (Kapa Biosystems, Woburn, MA) before cluster generation.
-
bioRxiv - Developmental Biology 2023Quote: ... Libraries were prepared by the Van Andel Genomics Core from 1ug of total RNA using the KAPA stranded mRNA kit (v5.16) (Kapa Biosystems, Wilmington, MA USA). RNA was sheared to 300-400 bp ...
-
bioRxiv - Neuroscience 2023Quote: ... Multiplexed library pool QC was based on Agilent Tapestation 4200 HS D1000 and Kapa Library Quantification Kit for Illumina platforms (Kapa BioSystems, Boston, MA) and sequenced at shallow depths on Illumina’s iSeq 100 v2 flow cell for 26×10×10×90 cycles for estimated reads per cell ...
-
bioRxiv - Immunology 2023Quote: ... and adapter-ligated using the KAPA PCR-free Hyper Prep Kit in combination with KAPA Unique Dual-Indexed Adapters (F. Hoffmann-La Roche AG, Basel, Switzerland). Adapter-ligated libraries were purified by AMPure XP bead cleanup ...
-
bioRxiv - Zoology 2023Quote: ... Digoxigenin-labeled antisense and sense RNA probes were produced from cloned PCR fragments using a digoxigenin RNA labeling kit (SP6/T7; Roche Diagnostics, Basal, Switzerland). Labeling was performed as previously described (Ukena et al. ...
-
bioRxiv - Physiology 2023Quote: ... Library for RNA-Seq was prepared according to KAPA Stranded mRNA-Seq poly(A) selected kit with 201-300bp insert size (KAPA Biosystems, Wilmington, MA) using 250 ng total RNA as input ...
-
bioRxiv - Bioengineering 2023Quote: ... was subjected to second-strand synthesis in a 25 μl reaction volume using IGHV gene–specific primers (primer No.9–14) and a KAPA Biosystems kit (Roche, KAPA HiFi HotStart). The PCR conditions were as follows ...
-
bioRxiv - Developmental Biology 2023Quote: Probes for whole mount ISH and FISH were prepared with RT-PCR using primers listed in Table S7 followed by ligation into pGEM-T Easy vectors and transcribed using a DIG RNA labeling kit (Roche, Cat no. 11175025910), some probes were made using flourescein labeling mix (Roche ...
-
bioRxiv - Immunology 2023Quote: ... following by the secondary antibody incubation and chromogenic detection with DISCOVERY Purple and Yellow kits (Ventana-Roche Diagnostics, #760-229 and # 760-239). These chromogenic dyes are covalently deposited and have unique spectra (83 ...
-
bioRxiv - Molecular Biology 2022Quote: ... Libraries were prepared by the Van Andel Genomics Core from 500 ng of total RNA using the KAPA RNA HyperPrep Kit with RiboseErase (v1.16) (Kapa Biosystems, Wilmington, MA USA). RNA was sheared to 300-400 bp ...
-
bioRxiv - Developmental Biology 2022Quote: ... Digoxygenin-labeled sense and antisense probes were synthesized from the linearized plasmids using the DIG RNA Labeling Kit (SP6/T7) (Roche/MilliporeSigma, Burlington, MA). Whole-mount ISH was performed as previously described (Yan et al. ...
-
bioRxiv - Neuroscience 2022Quote: ... Real-time RT-PCR was then performed using the KAPA SYBR FAST qPCR Master Mix (2x) Kit (Kapa Biosystems, Cape Town, South Africa) in LightCycler 480® (Roche ...
-
bioRxiv - Genomics 2023Quote: ... DNA-Seq libraries were prepared from 1 mg of DNA extracted from young leaves using the Kapa LTP library prep kit (Kapa Biosystems, MA, USA). After quantity and quality evaluation with the High Sensitivity chip of a Bioanalyzer 2100 (Agilent Technologies ...
-
Tryptophan Metabolites And Their Predicted Microbial Sources In Fecal Samples Of Healthy IndividualsbioRxiv - Microbiology 2024Quote: ... Libraries were amplified for 13 PCR cycles in 50 μl reactions containing 150 pmol of P1.1 (5’-AATGATACGGCGACCACCGAGA) and P3 (5’-CAAGCAGAAGACGGCATACGAGA) primer and Kapa HiFi HotStart Library Amplification kit (Cat# kk2612, Roche Sequencing and Life Science). Library quantification and size estimation were performed using a Fragment Analyzer (Agilent Technologies ...
-
bioRxiv - Neuroscience 2024Quote: ... brain sections were processed for DNA strand breaks using Terminal deoxynucleotidyl transferase dUTP nick end labeling (TUNEL) from Fluorescence In Situ Cell Death Detection kit (Roche Diagnostic, Indianapolis, IN) according to the manufacturer’s instructions.
-
bioRxiv - Pathology 2024Quote: ... The resulting PCR products were then used as a template for generation of sense and antisense DIG-labelled probes using a DIG-nucleotide labelling kit (Roche, Indianapolis, IN, USA). Hybridised probes within the nematode tissues were detected using an anti-DIG antibody conjugated to alkaline phosphatase and its substrate ...
-
bioRxiv - Genetics 2024Quote: ... Strand-specific and dual-barcode indexed RNA-seq libraries were generated from 450 ng total RNA each using the Kapa RNA-seq Hyper kit (Kapa Biosystems-Roche, Basel, Switzerland) and both the QIAseq FastSelect–5S/16S/23S ribodepletion and FastSelect rRNA Plant reagents (Qiagen ...
-
bioRxiv - Genetics 2024Quote: ... they were quantified on a CFX 384 Touch Real-Time PCR Detection System using the KAPA Library Quantification Kit (KAPA Biosystems, cat. KK4824). Finally ...
-
bioRxiv - Cell Biology 2024Quote: ... We used the Agilent Bioanalyzer to assess the quality of the library and a qPCR approach with the KAPA Library Quantification Kit (Roche; P/N: KK4873) on the QuantStudio 12K device to quantify the library ...
-
bioRxiv - Molecular Biology 2024Quote: ... Illumina adapters (AGA TCG GAA GAG CGT CGT GTA GGG AAA GAG TGT AGA TCT CGG TGG TCG CCG TAT CAT T and AAT GAT ACG GCG ACC ACC GAG ATC TAC ACT CTT TCC CTA CAC GACGCT CTT CCG ATC TNN***) were ligated and DNA-cDNA chimeras were then amplified with the KAPA HiFi kit (Roche, Cat. No. 07958838001). PCR products were enriched for fragments >200 bp and sequenced on a NextSeq2000 instrument (Illumina ...
-
bioRxiv - Cell Biology 2023Quote: ... The mRNA-seq library was prepared using poly (A)-tailed enriched mRNA at the UT Cancer Genomics Center using the KAPA mRNA HyperPrep Kit protocol (KK8581, Roche, Holding AG, Switzerland) and KAPA Unique Dual-indexed Adapter kit (KK8727 ...
-
bioRxiv - Plant Biology 2024Quote: ... The resulting PCR products were then used as a template for generation of sense and antisense DIG-labelled probes using a DIG-nucleotide labelling kit (Roche, Indianapolis, IN, USA). Hybridised probes within the nematode tissues were detected using an anti-DIG antibody conjugated to alkaline phosphatase and its substrate ...
-
bioRxiv - Cell Biology 2024Quote: ... 72°C for 3 min and final 72 °C for 5 min) using KAPA HiFi Hotstart Readymix PCR Kit (Kapa Biosystems, Cat: KK2602) and SMART PCR Primer (AAGCAGTGGTATCAACGCAGAGT) ...
-
bioRxiv - Microbiology 2023Quote: ... 0.09 ng of cDNA per well was used in qRT-PCR with KAPA SYBR® FAST qPCR Master Mix Kit (2×) (KAPA Biosystems, USA) on an Applied StepOnePlusTM Real-Time PCR System (Applied Biosystems ...
-
bioRxiv - Neuroscience 2023Quote: ... The concentration of ligated fragments in each library was quantified with the KAPA Library Quantification Kits for Illumina platforms (Roche/KAPA Biosystems, KK4824) on a Roche LightCycler 480 Instrument (Roche) ...
-
bioRxiv - Cancer Biology 2023Quote: ... We determined the size of the final library construct on the Caliper LabChip GX system and quantified it using qPCR SYBR Green reactions with a set of DNA standards and the Kapa Library Quantification Kit (KAPA Biosystems, Part#KK4854). Size and concentration values were entered into the WikiLIMS database for the sequencing team’s use for appropriate flow-cell loading ...
-
bioRxiv - Microbiology 2023Quote: First-strand cDNA synthesis and quantitative real-time PCR was performed using the KAPA SYBR® FAST kit (CliniSciences) on the LightCycler® 480 (Roche Diagnostics) using the primers indicated in Supplementary Table S6 ...
-
bioRxiv - Cell Biology 2023Quote: ... Reverse transcription and real-time qPCR reaction were carried out with KAPA SYBR FAST One-Step qRT-PCR Master Mix Kit (KAPA Biosystems, Wilmington, MA) on LighyCycler 480 system (Roche ...
-
bioRxiv - Microbiology 2022Quote: ... #439259) or HeV (Advanced Cell Diagnostics Inc #410719) and detected using the Discovery mRNA purple HRP detection kit (Roche Tissue Diagnostics #760-255) on the Ventana Discovery ULTRA staining platform (Roche Tissue Diagnostics) ...
-
bioRxiv - Developmental Biology 2022Quote: Testes from adult mice were cut into ~20 mg pieces and transferred into ~200 μl pre-cooled denaturing buffer from the Minute Total Protein Extraction Kit (SD-001, Invent Biotech, Plymouth, MN, USA) containing protease inhibitors (CO-RO, Roche, Indianapolis, IN, USA) and phosphatase inhibitors (PHOSS-RO ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... We prepared dual- indexed libraries (Glenn et al. 2019) for targeted enrichment using the KAPA Hyper Prep Library Kit (KAPA Biosystems, Wilmington, MA) following manufacturer’s protocols ...
-
bioRxiv - Genetics 2022Quote: ... Sense and antisense digoxigenin (DIG)-labeled probes were synthesized from the purified PCR product using DIG RNA Labeling Kit (Roche, cat. no.11175025910). All primer sequences were listed in Supplementary Information (Supplementary Table 3).
-
bioRxiv - Genetics 2022Quote: Southern blot analysis was performed to ensure that the foreign gene Bar was present in randomly excised segments of the T2 transformed soybean genome by following the protocol from the DIG High Prime DNA Labeling and Detection Starter Kit I (Roche, Indianapolis, IN, USA). DNA was extracted from the plants with positive PCR results ...
-
bioRxiv - Developmental Biology 2022Quote: ... QPCR was performed using the LightCycler® FastStart DNA Master PLUS SYBR Green I kit and a light cycler 2.0 (Roche Life Science, France) as previously reported 7
-
bioRxiv - Cancer Biology 2023Quote: ... Libraries were prepared by the Van Andel Genomics Core from 500 ng of total RNA using the KAPA mRNA Hyperprep kit (v4.17) (Kapa Biosystems, Wilmington, MA USA). RNA was sheared to 300-400 bp ...
-
bioRxiv - Genomics 2023Quote: ... Bank validation was done with the quantification of the complementary DNA with the Standard Sensitivity NGS kit on Fragment Analyzer and with qPCR (ROCHE Light Cycler 480). The sequencing was done on NovaSeq 6000 (Illumina ...
-
bioRxiv - Genomics 2023Quote: ... The concentration of each library was determined by quantitative PCR (qPCR) via the KAPA Library Quantification Kit for Next Generation Sequencing (KAPA Biosystems; Woburn, MA).
-
bioRxiv - Microbiology 2023Quote: ... and the concentration was measured with the Qubit®/Quant-IT® Fluorometric Quantitation and/or KAPA Library Quantification kit for Illumina platform (KAPA Biosystems). Paired-end sequencing (read length 100 bp ...
-
bioRxiv - Genomics 2023Quote: DNA was purified from 200μL Aptima tube specimens using the MagNA Pure Total Nucleic Acid Isolation Kit I (Roche Applied Science, Indianapolis, IN) external lysis protocol on the automated MagNA Pure 24 Instrument and 50µL elution ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... A volume of 50 µl (1 µg) of sheared DNA from each sample was used for library preparation using a KAPA Hyper Prep Illumina Kit (KAPA Biosystems, Wilmington, MA) and 48 barcoded adaptors (Bioo Scientific ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... and ligated to iTru adapters followed by limited-cycle PCR of iTru primers to add indexes and complete the library molecules using Kapa Library Preparation Kit reagents (Kapa Biosystems [Roche, Basel, Switzerland]). We sequenced the pooled libraries on an Illumina sequencer (Illumina ...
-
bioRxiv - Neuroscience 2024Quote: ... The concentration of each library was accurately determined through qPCR utilizing the KAPA library Quantification Kit according to the manufacturer’s protocol (KAPA Biosystems/Roche cat# KK4824) to produce cluster counts appropriate for the Illumina NovaSeq6000 instrument ...
-
bioRxiv - Cell Biology 2024Quote: ... The cDNA libraries were quantitated using qPCR in a Roche LightCycler 480 with the Kapa Biosystems kit for Illumina library quantitation (Kapa Biosystems, Woburn, MA) prior to cluster generation ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... We then amplified the adapter-ligated libraries with indexing oligos (Glenn lab, University of Georgia) and the KAPA HiFi PCR Kit (Roche, Indianapolis, Indiana, USA) using 16 cycles of PCR ...
-
bioRxiv - Developmental Biology 2024Quote: TUNEL assays were carried out on 10 µm cryosections following the manufacturer’s protocol in the Fluorescein in Situ Cell Death Detection kit (Roche Applied Science, Indianapolis, IN).