Labshake search
Citations for Roche :
5051 - 5100 of 5547 citations for Parallel Artificial Membrane Permeability Assay PAMPA Kit since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2024Quote: ... The consecutive IF detection system for the above-mentioned sequence of antibodies was developed by using the Discovery FITC kit (catalog no. 760-232, Roche-Ventana), Discovery Red 610 (catalog no ...
-
bioRxiv - Cancer Biology 2024Quote: ... The samples were developed by using either secondary antibodies linked to horseradish peroxidase with the UltraView™ Universal DAB Detection Kit (Ventana Medical System, Roche) or secondary antibodies linked to fluorophores ...
-
bioRxiv - Cell Biology 2024Quote: ... assay was performed following our previous publication(4, 55) and the instruction of In Situ Cell Death Detection Kit TMR red (Roche, 12156792910). Cells were cultured on coverslips for 36 h ...
-
bioRxiv - Microbiology 2024Quote: ... and phoD-R1083 (5’-CTG SGC SAK SAC RTT CCA-3’) (Ragot et al., 2015) in 25 µL reactions with KAPA2G Robust HotStart PCR kit (KAPA Biosystems, Roche ...
-
bioRxiv - Microbiology 2024Quote: ... and phoD-R1083 (5’-CTG SGC SAK SAC RTT CCA-3’) (Ragot et al., 2015) in 25 µL reactions with KAPA2G Robust HotStart PCR kit (KAPA Biosystems, Roche; 0.5 U KAPA2G Robust HotStart DNA Polymerase ...
-
bioRxiv - Molecular Biology 2024Quote: ... Library quality control was performed with an Agilent 2100 Bioanalyzer and quantity determined via the KAPA Library Quantification Kit (KAPA Biosystems). WGBS libraries were then pooled to meet the required 1µg DNA input necessary for targeted enrichment ...
-
bioRxiv - Molecular Biology 2023Quote: ... Library QC was done using Qubit and BioAnalyzer and the final libraries were quantified using KAPA Library Quantification Kit (Roche, 07960140001). Libraries were diluted to 2 nM final concentration for pooling ...
-
bioRxiv - Neuroscience 2024Quote: ... Tissues were washed three times with TBS-T and were incubated with a TUNEL reaction mixture (In Situ Cell Death Detection Kit, TMR red, Roche 12156792910) for 1 h at 37 °C ...
-
bioRxiv - Genomics 2024Quote: ... We used 10 ng of DNA from two biological replicates to generate sequencing libraries using KAPA Hyper Prep Kit (KAPA Biosystems) according to the manufacturer’s instructions ...
-
bioRxiv - Genomics 2024Quote: ... mRNA was then isolated and RNA-Seq library was prepared following the KAPA RNA HyperPrep Kit protocol (Roche, Cat. No: 08098123702). The RNA- seq libraies were sequenced by NovaSeq 6000 (Illumina ...
-
bioRxiv - Developmental Biology 2024Quote: Pitx1 WISH was performed on E12.5 embryos with a digoxigenin-labelled Pitx1 antisense probe designed from a cloned antisense probe (PCR DIG Probe Synthesis Kit, Roche 11636090910). Experimental procedure followed the protocol outlined in (Kragesteen et al. ...
-
bioRxiv - Genomics 2024Quote: ... Adapted fragments were amplified by 12 cycles of PCR using the Kapa Hifi Hotstart NGS library Amplification kit (Roche, Basel, Switzerland), followed by 0.8x AMPure XP (Beckman Coulter Genomics ...
-
bioRxiv - Developmental Biology 2024Quote: ... the tail of each embryo was collected for genomic DNA extraction using the KAPA Mouse Genotyping Kit HotStart (Kapa Biosystems, KK7352). Subsequently ...
-
bioRxiv - Cell Biology 2024Quote: ... and a sgRNA preceded by a rrk1 leader and followed by a Hammerhead Ribozyme as described in [17] was digested and prepared for gap repair as follows: the vector pJB166 was purified from DH5α bacterial cells using the Genopure plasmid midi kit (Roche, 03143414001) and diluted to 1 μg/μL ...
-
bioRxiv - Cell Biology 2023Quote: The tissues from treated mice and HFs were used for TUNEL apoptotic detection (In Situ Cell Death Detection Kit, TMR Red, Roche 12156792910) After fixation and antigen retrieval procedures ...
-
bioRxiv - Immunology 2023Quote: ... Wells were pre-coated with 100 μL per well of capture anti-histone antibody contained in the Cell Death Detection ELISA kit (1:40 in 1x coating buffer; Roche 11544675001) or anti-myeloperoxidase (MPO ...
-
bioRxiv - Genomics 2023Quote: ... Final library concentration was quantified using size distribution by the Agilent 2200 Tape Station and/or qPCR using the Library Quantification Kit (KK4854, Kapa Biosystems). Equimolar amounts of each library were pooled prior to multiplex sequencing ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... Libraries were quantified using the Qubit BR dsDNA assay kit and equimolar pools were quantified by real-time PCR against a standard curve using the KAPA Library Quantification Kit (Kapa Biosystems). Libraries were sequenced on the NovaSeq 6000 Illumina platform in 150PE mode ...
-
bioRxiv - Genomics 2023Quote: ... Reverse transcription and second strand synthesis was performed on the slide with cDNA quantification using qRT-PCR using KAPA SYBR FAST-qPCR kit (KAPA Biosystems) and analysed on the QuantStudio (ThermoFisher) ...
-
bioRxiv - Neuroscience 2023Quote: ... Quantitative real time PCRs (qPCRs) were performed in a total volume of 10 µl with Kapa SYBR Fast qPCR kit (KAPA Biosystems) on an ABI 7500 fast machine operated with ABI 7500 software (Applied Biosystems) ...
-
bioRxiv - Developmental Biology 2023Quote: TUNEL staining was performed according to the manufacturer’s protocol with minor modifications (In Situ Cell Death Detection Kit, TMR red; catalogue number 12156792910; Roche, Mannheim, Germany). Briefly ...
-
bioRxiv - Cell Biology 2023Quote: DNA was extracted from a cell suspension containing approximately 5x 105 cell/ ml using MagNA Pure 96 DNA and Viral NA Small Volume Kit in Magna pure 96 as instructed by the manufacture (Roche, Germany). DNA concentration was measured by NanoDrop 2000 instrument (Thermo Scientific ...
-
bioRxiv - Plant Biology 2024Quote: ... Digoxigenin-labeled sense and antisense RNA probes based on the sequence of TaABI3-A1 were synthesized using a DIG northern Starter Kit (Roche, 11277073910), according to the manufacturer’s instructions ...
-
Dysregulated expanded endocannabinoid system as therapeutic targets of amyotrophic lateral sclerosisbioRxiv - Neuroscience 2024Quote: ... The libraries were quantified using KAPA Library Quantification kits for Illumina Sequencing platforms according to the qPCR Quantification Protocol Guide (KAPA BIOSYSTEMS) and qualified using the TapeStation D1000 ScreenTape (Agilent Technologies) ...
-
bioRxiv - Systems Biology 2024Quote: ... Shotgun metagenomic sequencing libraries were prepared using a miniaturized version of the Kapa HyperPlus Illumina-compatible library prep kit (Kapa Biosystems). DNA extracts were normalized to 5 ng total input per sample using an Echo 550 acoustic liquid handling robot (Labcyte Inc) ...
-
bioRxiv - Molecular Biology 2024Quote: ... The V4–V5 regions of 16S rRNA gene were amplified using specific primers and libraries were constructed using the Hyper Library Preparation Kit from Kapa Biosystems (Roche Diagnostics ...
-
bioRxiv - Microbiology 2023Quote: ... Indexed libraries that meet appropriate cut-offs for both are quantified by qRT-PCR using a commercially available kit (KAPA Biosystems) and insert size distribution determined with the LabChip GX or Agilent Bioanalyzer ...
-
bioRxiv - Microbiology 2023Quote: ... Library prep included fragment end treatment, A-tailing, and ligation of Illumina-compatible adapters (IDT, Inc.) using the Kapa-HyperPrep kit (Kapa Biosystems). DNA was then sequenced 2 x 150 bp on the Illumina NovaSeq 6000 platform using S4 flow cells ...
-
bioRxiv - Neuroscience 2023Quote: A total of 1.0 µg of extracted DNA was used for PCR-free library construction using the KAPA HyperPrep PCR-Free Library Prep kit (Roche, KK8505). Mechanical shearing using the Covaris microtube system (Covaris ...
-
bioRxiv - Cancer Biology 2023Quote: ... 1 µg of RNA from each sample was processed using the KAPA Stranded mRNA-Seq Kit with mRNA Capture Beads (Kapa Biosystems). Sequencing was performed using NextSeq 500 (Illumina) ...
-
bioRxiv - Cell Biology 2023Quote: Libraries were pooled in equimolar amounts and the final library pool was quantified using the KAPA Library Quantification Kit for Illumina Platforms (Roche; KK4824). Libraries were sequenced on the Illumina NextSeq 500 over two NextSeq 500 High Output v2.5 150 cycle kits (Illumina ...
-
bioRxiv - Microbiology 2023Quote: ... The RNA was then extracted with the Viral NA Small volume kit (06 543 588 001, Roche Diagnostics GmbH (Mannheim, Germany)) on the MagNA Pure 96 system (Roche Diagnostics GmbH (Manheim ...
-
bioRxiv - Molecular Biology 2023Quote: Automated dual indexed FFPE libraries were constructed with 50-250 ng of genomic DNA utilizing the KAPA HTP Library Kit (KAPA Biosystems) on the SciClone NGS instrument (Perkin Elmer ...
-
bioRxiv - Neuroscience 2023Quote: ... All purified nucRNA (9-20 ng/sample) was used to construct cDNA sequencing libraries using the KAPA RNA HyperPrep Kit with RiboErase (KK8560, KAPA Biosystems), following the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2023Quote: ... The concentration of each library was accurately determined through qPCR utilizing the KAPA library Quantification Kit according to the manufacturer’s protocol (KAPA Biosystems/Roche) to produce cluster counts appropriate for the Illumina NovaSeq6000 instrument ...
-
bioRxiv - Cell Biology 2023Quote: ... 5 ng of DNA from each sample was analyzed using the Kapa Cyber Fast Q-PCR Kit (Kapa Biosystems, Wilmington, MA). The following rDNA primers (designed using Primer3Plus software ...
-
bioRxiv - Cancer Biology 2023Quote: ... and quantified using the qPCR-based quantification in order to ensure only NGS-compatible amplicon was quantified using the Library Quant ROX Low Kit (Kapa Biosystems) on a QuantStudio™ 6 Realtime PCR System (ThermoFisher) ...
-
bioRxiv - Immunology 2022Quote: ... A total amount of 200ng RNA per sample was used for the preparation of RNA sequencing libraries using the KAPA RNA HyperPrep Kit with RiboErase (HMR) (KAPA Biosystems). In short ...
-
bioRxiv - Microbiology 2022Quote: Ten nanograms of cDNA were used as a template in a 5 μl reaction mixture from a KAPA SYBR FAST qPCR kit (Kapa Biosystems). Primers used are listed in Table S2 ...
-
bioRxiv - Immunology 2022Quote: ... and a primer complementary to the template-switch adapter (5’ TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGAAGCAGTGGTATCAACGCAG, adapter in italic) with the KAPA Real-Time Library Amplification Kit (Kapa Biosystems). Adapters were required for subsequent sequencing reactions ...
-
bioRxiv - Microbiology 2022Quote: ... The cDNA libraries were quantitated using qPCR in a Roche LightCycler 480 with the Kapa Biosystems kit for Illumina library quantitation (Kapa Biosystems) prior to cluster generation.
-
bioRxiv - Neuroscience 2022Quote: ... Cerebellar specimen gained from 4-weeks old Prpf8Y2334N mice were processed using KAPA RNA Hyperprep Kit with RiboErase (Kapa Biosystems/Roche) due to discontinuation of the Lexogen library construction kit ...
-
bioRxiv - Neuroscience 2022Quote: ... Cerebellar specimen gained from 4-weeks old Prpf8Y2334N mice were processed using KAPA RNA Hyperprep Kit with RiboErase (Kapa Biosystems/Roche) due to discontinuation of the Lexogen library construction kit ...
-
bioRxiv - Developmental Biology 2022Quote: ... The libraries were quantified by fluorometry on a Qubit instrument (LifeTechnologies, Carlsbad, CA) and by qPCR with a Kapa Library Quant kit (Kapa Biosystems-Roche) prior to sequencing ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... We prepared the WGBS libraries according to MethylC protocol (Urich et al., 2015) and quantified them using a combination of KAPA Library Quantification kits (Kapa Biosystems) and an Agilent High Sensitivity DNA kit (Agilent Genomic) ...
-
bioRxiv - Physiology 2022Quote: ... 250 ng of total RNA was used to prepare barcoded RNA-seq libraries using Stranded RNA-Seq Kit with RiboErase (KAPA Biosystems). Samples were sequenced on the HiSeq 2500 (Figure 2 ...
-
bioRxiv - Cancer Biology 2022Quote: ... Library quality control was performed with an Agilent 2100 Bioanalyzer and quantity determined via the KAPA Library Quantification Kit (KAPA Biosystems).
-
bioRxiv - Bioengineering 2022Quote: The open-reading frame of the nikABCDE gene was amplified from genomic DNA belonging to Escherichia coli BL21(DE3) using the KAPA-HiFi Master Mix kit according to the manufacturer’s instructions (Kapa Biosystems, #KK2601). Primers are found in Supplementary Table 3 ...
-
bioRxiv - Cancer Biology 2022Quote: ... We next amplified full-length 1.7kb NT5C2 DNA insert by PCR using KAPA HiFi HotStart ReadyMix PCR Kit (Kapa Biosystems, #KK2601) and the following primers ...
-
bioRxiv - Cell Biology 2022Quote: ... Real-time PCR was carried out with the Light Cycler Fast Start DNA Master SYBR Green Kit (Roche Applied Science, Germany) using LightCycler (Roche Applied Science ...