Labshake search
Citations for Agilent :
1151 - 1200 of 1403 citations for rno mir 143 RT PCR Primer Set since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2020Quote: A library encoding ARHGAP36 isoform 2 mutants was created via error-prone PCR (epPCR) using the GeneMorph II Random Mutagenesis Kit (Agilent). To determine the optimal epPCR conditions for library generation ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... RNA probes were synthetized by cloning the DNA amplified region in the Strataclone PCR Cloning Kit (240205-5, Agilent Technologies) (hoxd12a ...
-
bioRxiv - Biochemistry 2022Quote: ... a DNA fragment spanning PasI and DraIII sites of pCAG-MV-GagPol-CTEx2 was PCR-amplified and ligated between BamHI and XhoI sites of pBluescript II KS(+) (Stratagene). AgeI and XhoI restriction sites flanking the IN-coding region were introduced by silent mutagenesis ...
-
bioRxiv - Molecular Biology 2021Quote: ... Thermal stability at a constant 37°C was measured by a thermal shift assay using a Mx3000p real-time PCR instrument (Agilent technologies ...
-
bioRxiv - Cell Biology 2022Quote: ... The R149W mutation in YME1L1 was introduced by PCR-based site-directed mutagenesis using the Pfu Turbo DNA polymerase (Stratagene). The Tim22 mutant and other overexpression constructs used in this study are described in detail in an earlier report (Kumar et al. ...
-
bioRxiv - Genomics 2020Quote: ... the amplified libraries were purified using a Qiagen MinElute PCR Purification Kit and eluted in 20 μl Elution Buffer before quantitation on an Agilent 4200 TapeStation (Agilent Technologies LDA UK Limited ...
-
bioRxiv - Genomics 2019Quote: ... qRT-PCR was run on a Roche Lightcycler 480 using the Brilliant II SYBR Green qPCR Master Mix (Stratagene, 600804) using the following primers ...
-
bioRxiv - Developmental Biology 2019Quote: Pkin-29::kin-29SER517ALA was generated by modifying Pkin-29::kin-29cDNA using PCR-based mutagenesis (Quickchange II XL site-directed mutagenesis kit, Stratagene). The following primers were used ...
-
bioRxiv - Molecular Biology 2020Quote: ... the gene of FASTD71V,P73T was randomly mutagenized by error-prone PCR using the GeneMorph II Random Mutagenesis Kit (Agilent). The PCR product was digested with NheI and BamHI ...
-
bioRxiv - Genomics 2019Quote: ... Approximately one-third of the library was amplified over three 70 μl PCR reactions using 5 μl of template each and Herculase II Fusion DNA Polymerase (Agilent). The products were MinElute purified ...
-
bioRxiv - Neuroscience 2019Quote: ... All GFP-Parkin variants were generated using PCR mutagenesis on the GFP-Parkin WT plasmid (addgene#45875) according to the manufacturer’s protocol (Agilent Technologies). Constructs were verified by Sanger sequencing.
-
bioRxiv - Molecular Biology 2019Quote: ... PCR was carried out in a 20 μl reaction volume containing 10 μl Brilliant III SYBR Green Master Mix (Agilent), 500 nM of primers ...
-
bioRxiv - Microbiology 2019Quote: ... The relative expression levels of targeted genes were measured by qRT PCR using Brilliant III ultra-fast SYBR green QPCR mix (Stratagene) in an Applied Biosystems 7500 Real-Time PCR system ...
-
bioRxiv - Molecular Biology 2019Quote: ... Quantitative real-time PCR (qPCR) was assayed in 10 μl reactions with Brillant III Ultra Fast SYBR-Green Mix (Agilent) using a Stratagene MX3005p system ...
-
bioRxiv - Cell Biology 2019Quote: ... Single-point mutants in PACRG were generated by PCR mutagenesis using the QuickChange II Site Directed Mutagenesis kit (Agilent Technologies). The pDB070.iodo.5 plasmid containing the modified tRNA and tRNA synthetase for p-iodo-L-phenylalanine incorporation was obtained from Addgene (#99397 ...
-
bioRxiv - Neuroscience 2019Quote: ... the mouse cDNA sequence for Ntrk2 (GenBank accession number X17647, nucleotides 188-722) was amplified by PCR and cloned into pBluscript II KS (-) plasmid (Stratagene). Antisense probes were synthesized with T3 RNA polymerase (Promega #2083 ...
-
bioRxiv - Immunology 2021Quote: ... were performed with PerfeCTa SYBR green SuperMix (Quanta BioScience) using fast two-step cycling performed in a Mx3005P real time PCR machine (Stratagene) and included an initial 2 min enzyme activation step at 95°C ...
-
bioRxiv - Plant Biology 2020Quote: ... except approximately 10 seedlings were used per RNA sample and analysis was performed using an MXPro 3005 real time PCR system (Agilent) with 5x HOT FIREPol EvaGreen qPCR mastermix (Solis Biodyne) ...
-
bioRxiv - Developmental Biology 2021Quote: ... a BirA-2A-Cherry-SV40pA-FRT-Kan-FRT cassette was PCR-amplified using Herculase II fusion DNA polymerase (Agilent Technologies) and recombined into the first coding exon of tcf21 within the DKEYP 79F12 BAC clone as previously described (Weinberger ...
-
Safety and efficacy of C9ORF72-repeat RNA nuclear export inhibition in amyotrophic lateral sclerosisbioRxiv - Systems Biology 2021Quote: ... qRT–PCR reactions were performed in duplicate using the Brilliant III Ultra-Fast SYBR Green QPCR Master Mix (Agilent Technologies) on a C1000 Touch™ thermos Cycler CFX96™ Real-Time System (BioRAD ...
-
bioRxiv - Bioengineering 2021Quote: ... All PCR reactions for cloning and amplification of sequencing templates were performed using Herculase II Fusion DNA Polymerase (Agilent Technologies), and using GoTaq (Promega ...
-
bioRxiv - Biochemistry 2020Quote: ... The error-prone PCR (epPCR) library of the gene encoding qmLC/A was created with the GeneMorph II kit (Agilent) according to the manufacturer’s instructions ...
-
bioRxiv - Biophysics 2020Quote: Mutations were generated in previously-described single-round plasmid derivatives of HIV-1NL4-3 (pNLdE-luc)48 and HIV-1LAI (pBru3ori-ΔEnv-luc2)49 that encoded for luciferase via the QuikChange site-directed PCR mutagenesis kit (Agilent). Resulting plasmid DNAs were verified by Sanger sequencing ...
-
bioRxiv - Cell Biology 2021Quote: PCR amplification of inserted sgRNAs from the genomic DNA was done with the Herculase II Fusion DNA Polymerase (Agilent Technologies) using the primers oMCB-1562 and oMCB-1563 ...
-
bioRxiv - Microbiology 2020Quote: ... the absence of DNA contamination was conformed using by PCR and the quality and quantity of the RNA samples was established using a 2100 Bioanalyzer (Agilent). Samples were sent for 150 bp paired-end sequencing via an Illumina platform and bioinformatic analysis ...
-
bioRxiv - Cell Biology 2021Quote: Expression vectors were produced either by homologous recombination with PCR-amplified or synthetic genes and amplified backbones or site directed mutagenesis (QuikChange, Agilent). The wild type (Kumar et al. ...
-
bioRxiv - Plant Biology 2020Quote: ... Quantitative PCR was done using the Brilliant III Ultra-Fast SYBR® Green Master mix (Agilent Technologies, Santa Clara, CA) in an AriaMx (Agilent Technologies ...
-
bioRxiv - Plant Biology 2021Quote: ... Relative and quantitative expression in leaves and spikes was analyzed using Real-Time PCR Detection Machine (Stratagene Mx3005P, Agilent Technologies) and KAPA SYBR® FAST qPCR Master Mix (2X ...
-
bioRxiv - Plant Biology 2021Quote: ... Relative and quantitative expression in leaves and spikes was analyzed using Real-Time PCR Detection Machine (Stratagene Mx3005P, Agilent Technologies) and KAPA SYBR® FAST qPCR Master Mix (2X ...
-
bioRxiv - Microbiology 2021Quote: A library of IpaC mutants with missense mutations in the coiled-coil domain and flanking regions was generated using error-prone PCR with the GeneMorphII (Agilent) domain mutagenesis kit ...
-
bioRxiv - Systems Biology 2020Quote: ... 3.5 μl/well was then used as template for 2nd PCR in a 50 μl reaction together with 0.5 μl Herculase II fusion DNA polymerase (Agilent Technologies), 10 μl 5* Herculase II reaction buffer ...
-
bioRxiv - Molecular Biology 2020Quote: ... Differentially labeled (Cy5–IgA-; Cy3–IgA+) half hairpin amplicons were PCR amplified and allowed to undergo competitive hybridization onto microarrays (Agilent). Candidate negative regulators were identified as genes that are enriched in the IgA+ population at least 2-fold over the IgA-population ...
-
bioRxiv - Biophysics 2022Quote: ... pcDNA3-Src K5R/K7R/K9R (Src 3R) mutants were obtained by PCR using the QuickChange Site-Directed Mutagenesis Kit (Stratagene); forward 5’:CCCTTCACCATGGGTAGCAACAGGAGCAGGCCCAGGGATGCCAGCCAGCGGCGCCGC ...
-
bioRxiv - Biophysics 2022Quote: All of mutations in this study were made by using overlap-extension polymerase chain reaction (PCR) with Pfu polymerase (Stratagene) on the template of the mbr5 splice variant of mslo1 (Uniprot ID ...
-
bioRxiv - Biochemistry 2022Quote: ... The preparation of variants was achieved through an error-prone PCR mutagenesis kit (GeneMorph II Random Mutagenesis Kit – Agilent Technologies), following the manufacturer’s instructions in order to insure high proportion of single-mutant variants ...
-
bioRxiv - Genomics 2022Quote: ... The library was amplified using 8 PCR cycles and verified on a Fragment Analyzer using the HS NGS fragment kit (Agilent). The library was quantified by qPCR using the KAPA Library quantification kit (Roche ...
-
bioRxiv - Plant Biology 2021Quote: ... Final libraries were amplified with 17 cycles of PCR and assessed on the Bioanalyzer with the High Sensitivity DNA kit (Agilent). All root tissue libraries that were sequenced comprised two biological replicates.
-
bioRxiv - Microbiology 2021Quote: ... a ∼700 bp region in the S gene containing the P681H mutation and a ∼300 bp NSP3 covering the 3675-3677 deletion were amplified by PCR using Pfu UltraII (Agilent) using the following primers:
-
bioRxiv - Molecular Biology 2020Quote: ... Converted libraries were enriched by 10 cycles of PCR with the following reaction composition: 1 μl Pfu TurboCx Hotstart DNA polymerase (Stratagene), 5 μl PfuTurbo Cx reaction buffer ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... with 15 PCR cycles used for the final amplification step and passed through quality control using a 2100 Bioanalyzer (Agilent). Both quality control and sequencing was carried out at Babraham Institute Next Generation Sequencing facility ...
-
bioRxiv - Biochemistry 2020Quote: ... and the fluorescence signals corresponding to temperature-dependent protein unfolding were measured using a Real-Time PCR Mx3005p machine (Stratagene). The melting temperature calculation was performed as described previously46.
-
bioRxiv - Biochemistry 2020Quote: Mutants were prepared by QuikChange® site-directed mutagenesis using the Pfu-Turbo Hotstart PCR Master Mix (Agilent, Waldbronn, Germany) according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2022Quote: ... Quality and quantity of PCR products were determined by using an Agilent 4150 TapeStation with High Sensitivity D5000 ScreenTape (Agilent). Final libraries were indexed using one of the 16 indexes for Illumina sequencing ...
-
bioRxiv - Genetics 2022Quote: ... A ∼400bp region around the expected Cas9 cut site in exon1 of EXOSC2 was amplified by PCR using PfuTurbo DNA polymerase (Agilent), according to the manufacturer’s instructions using primers ...
-
bioRxiv - Cancer Biology 2022Quote: ... sgRNA sequence libraries were prepared from genomic DNA by two rounds of PCR using the Herculase II Fusion DNA Polymerase (Agilent). sgRNA sequences were amplified by the primers oMCB1562 and oMCB1563 and then indexed using the Illumina TruSeq LT adaptor sequences (AD002 ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... Each sample pool was barcoded with a specific 10 bp-sequence attached at one side of the amplicons through PCR (7 cycles) and cleaned using AMPure beads (Agilent) at x0.7 ratio ...
-
bioRxiv - Microbiology 2019Quote: ... We used pMotB.com plasmid as the PCR template for these substitutions using a site-directed mutagenesis kit (QuikChange, Stratagene Inc.) yielding plasmids MotB(D24E ...
-
bioRxiv - Cancer Biology 2019Quote: Both types of libraries ligation products were enriched with 15 PCR cycles and the final library was validated on an Agilent 2100 Bioanalyzer with the Agilent DNA 1000 Kit (Agilent).
-
bioRxiv - Neuroscience 2019Quote: ... or Linker 2 (between Kv3.1 and miRFP670) were generated either by overlap extension PCR or using site-directed mutagenesis (QuickChange, Agilent, USA). Plasmid pPuro-CAG-CheRiff-IRES-NLS-mTagBFP2 encoding the optogenetic activating opsin CheRiff was made by subcloning CheRiff ...
-
bioRxiv - Cancer Biology 2020Quote: ... The quality and concentration of the PCR products was determined using a 2200 TapeStation and D1000 screen tapes (Agilent Technologies). To generate the NGS libraries ...