Labshake search
Citations for Agilent :
1101 - 1150 of 1403 citations for rno mir 143 RT PCR Primer Set since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Evolutionary Biology 2020Quote: ... The PCR products were purified (AMPure XP system) and the resulting libraries were analysed for size distribution by Agilent 2100 Bioanalyzer and quantified using real-time PCR ...
-
bioRxiv - Cancer Biology 2021Quote: ... The PCR products were cleaned up with SPRIselect beads and quantified using Qubit dsDNA HS assay kit (Agilent Technologies). The libraries were sequenced on a HiSeq2500 with paired-end 50-bp reads (Illumina).
-
bioRxiv - Biochemistry 2020Quote: The DNA template was amplified by the polymerase chain reaction (PCR) using Pfu high-fidelity DNA polymerase (Agilent Technologies). Each 50 μL reaction consisted of gDNA (∼27 ng ...
-
bioRxiv - Cell Biology 2021Quote: ... Plasmid point mutations were generated using Pfu Ultra polymerase by Quick Change PCR mutagenesis (Agilent Technologies, Santa Clara, CA). The resulting DNA constructs and strains were verified by DNA sequencing.
-
bioRxiv - Plant Biology 2021Quote: ... The genomic SPL7 (AT5G18830.1) coding region (translational start to stop codon) was PCR-amplified and cloned into the pBluescript SK+ vector (Stratagene/Agilent Technologies ...
-
bioRxiv - Cancer Biology 2021Quote: ... 73 and it was used to introduce the different point mutations in MAGI1 by mutagenesis PCR using PfuTurbo (Agilent). All the Gateway destination vectors are listed in the supplementary methods ...
-
bioRxiv - Molecular Biology 2022Quote: ... the glnA gene was amplified by PCR using the PfuUltra high-fidelity DNA polymerase AD from Agilent (CAT#600385) and the following specific primers ...
-
bioRxiv - Microbiology 2022Quote: Single-base alterations to plasmid sequences were performed using a PCR technique based on QuikChange site-directed mutagenesis (Stratagene).
-
bioRxiv - Microbiology 2021Quote: ... Cassettes and the template plasmid pM07704 were amplified by polymerase chain reaction (PCR) with Herculase II DNA polymerase (Stratagene). Marker-exchange plasmids were generated by ligation of the PCR products in α-select cells (Bioline ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... We produced the promoter inserts by performing error-prone PCR using the GeneMorph II Random Mutagenesis Kit (Agilent Technologies). We used 25 ng of the plasmid construct with the MG1655 lacZ promoter variant cloned into it as a template DNA for the error-prone PCR to achieve approximately 1.5 SNPs per variant sequence ...
-
bioRxiv - Genomics 2022Quote: ... The bisulfite-converted library was PCR amplified and indexed using the SureSelect XT Mouse Methyl-Seq Kit (Agilent, #G9651A). Prepared libraries were run on an Illumina sequencing platform using a NextSeq High 150 bp paired-end mode.
-
bioRxiv - Evolutionary Biology 2022Quote: ... PKR site-specific mutants and epteK3Δ227-508 were generated by PCR mutagenesis using the QuickChange Lightning mutagenesis kit (Agilent) and primers holding the desired mutations/deletions ...
-
bioRxiv - Molecular Biology 2019Quote: ... Real-time quantitative PCR (qPCR) was carried out on a Stratagene Mx3005p with Brilliant III SYBR Green kits (Stratagene) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2019Quote: ... The qPCR reaction was performed using Roche’s LightCycler and Brilliant II SYBR® Green QRT-PCR Master Mix (Agilent). We analyzed enrichment for target histone modifications by amplifying unique DNA barcodes at the 3’ end ...
-
bioRxiv - Cell Biology 2020Quote: ... P190RhoGAP-A mutants were produced through PCR-based site-directed mutagenesis using the Quikchange kit (Stratagene, San Diego, CA). For the Y1087F mutation ...
-
bioRxiv - Immunology 2020Quote: ... and subsequently mutagenized by error-prone PCR (ePCR) via the GeneMorph II Random Mutagenesis Kit (Agilent Technologies, Cat # 200550) with a target nucleotide mutation frequency of 0–4.5 mutations per kilobase of DNA ...
-
bioRxiv - Molecular Biology 2020Quote: ... Purified PCR products were quantified using Agilent Bioanalyzer 2100 Instrument using the High sensitivity DNA Kit (Agilent, 5067-4626). Ion Torrent Emulsion PCR and enrichment steps were performed using Ion PGM HiQ View OT2 kit (Life technologies ...
-
bioRxiv - Microbiology 2020Quote: ... Abundances of bacterial 16S rRNA genes were determined by quantitative PCR using Brilliant SYBR Green II Mastermix (Agilent Technologies) on a Mx3000P system (Agilent Technologies ...
-
bioRxiv - Cell Biology 2021Quote: ... was ligated into pCMV6-AC-HIS vector following incorporation of flanking restriction enzyme sites by PCR (SgfI AGGCGATCGCCATGAGCTGGGTGCAGGTCAACTT, MluI – GCGACGCGTACTTTGCCCCTGCTGCTGCTCTG) and grown in XL-10 Gold E.Coli (Agilent). Site directed mutagenesis (Q5-SDM – NEB ...
-
bioRxiv - Cancer Biology 2021Quote: ... The PCR products were detected by polyacrylamide gene electrophoresis or the Agilent DNA 1000 kit (Agilent Technologies Inc, Germany). Samples from the Innsbruck cohort and the remaining non-HPV16/18 samples from the Oslo cohort (n=40 ...
-
bioRxiv - Neuroscience 2020Quote: ... nucleotides: 907-1550) was amplified by the use of polymerase chain reaction (PCR) and cloned into pBluescript KS+ (Stratagene) via ClaI-EcoRI sites ...
-
bioRxiv - Biochemistry 2021Quote: Mutagenic PCR was used to introduce point mutations in both PgDHAR and HsCLIC1 (Table S2) following manufacturers protocol (Stratagene). 2-5μl of the PCR product was used to transform E ...
-
bioRxiv - Genomics 2021Quote: PCR was performed from each DNA sample for four regions (ORF21, ORF34, ORF46, and ORF18) using Herculase II (Agilent). Each region was then PCR purified (GeneJet ...
-
bioRxiv - Cell Biology 2021Quote: ... was used according to manufacturer’s instructions and the samples were run in triplicate on the AriaMx Real-time PCR System (Agilent). Relative quantification was performed using the 2-ddct method ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... PCR products were purified using the AMPure XP system and resulting libraries were analysed for size distribution by Agilent 2100 Bioanalyzer ...
-
bioRxiv - Molecular Biology 2022Quote: ... The resulting fragments were cloned into the StrataClone TA-cloning vector and transformed into StrataClone SoloPack competent cells according to the manufacturer’s protocol (StrataClone PCR Cloning Kit, Agilent), resulting in pFF-162 (SpoY) ...
-
bioRxiv - Molecular Biology 2022Quote: ... Mutagenesis was achieved by overlapping extension PCR using the Pfu Turbo® DNA polymerase (Stratagene, La Jolla, CA, USA). For the split luciferase experiments ...
-
bioRxiv - Plant Biology 2022Quote: ... All the qRT-PCR reactions were run on a Stratagene Mx 3005P apparatus (Agilent Technologies, Santa Clara, CA, USA) using the 5x HOT FIREPol® EvaGreen® qPCR Supermix kit (Solis BioDyne ...
-
bioRxiv - Cell Biology 2022Quote: ... The P937R mutation (c.C2810G) was introduced in the long homology arm by PCR-mediated mutagenesis (Quik-Change Lightning, Agilent), using the following primers ...
-
bioRxiv - Molecular Biology 2024Quote: FRET-melting measurements were recorded by an Agilent AriaMx Real-time PCR System (Agilent Technologies, Santa Clara, CA, USA) using 5’-FAM (6-carboxyfluorescein ...
-
bioRxiv - Molecular Biology 2024Quote: ... PCR products were assessed for purity and concentration on the Bioanalyzer using the High Sensitivity DNA Kit (Agilent Technologies). Samples were multiplexed and sequenced on the Illumina HiSeq 2500 system (Genome Technology Core ...
-
bioRxiv - Immunology 2023Quote: ... The cDNA content of pre-fragmentation and post-sample index PCR samples was analyzed using the 2100 BioAnalyzer (Agilent). Sequencing libraries were loaded on an Illumina Illumina NovaSeq 6000 flow cell ...
-
bioRxiv - Immunology 2024Quote: ... The cDNA content of pre-fragmentation and post-sample index PCR samples was analyzed using the 2100 BioAnalyzer (Agilent). Sequencing libraries were loaded on an Illumina NovaSeq flow cell at VIB Nucleomics core with sequencing settings according to the recommendations of 10x Genomics ...
-
bioRxiv - Bioengineering 2024Quote: ... Error-prone PCR reactions were carried out following the protocol provided by GeneMorph II Random Mutagenesis Kit (200550, Agilent). Primers were designed to flank residue 1 to 119 of the binder ...
-
bioRxiv - Cancer Biology 2023Quote: ... 4μl of the 128-bp PCR product were later checked on an 1.5% agarose gel and quantified for library generation by TapeStation (Agilent). NGS libraries were prepared from 30ng of the PCR product using the NEBnext Ultra II DNA library preparation kit for Illumina (New England Biolabs ...
-
bioRxiv - Microbiology 2023Quote: ... PCR amplification of pcDNA3.1-NS3-mCherry-HIS plasmid was done by using PfuUltra HotStart DNA Polymerase (Agilent, Cat #: 600390) and forward and reverse primers (table 2 ...
-
bioRxiv - Microbiology 2022Quote: ... The plate was then exposed to a temperature gradient for 3 min in a PCR machine (Agilent SureCycler 8800), followed by 3 min at room temperature ...
-
bioRxiv - Immunology 2023Quote: ... and PCR products were purified with VAHTS DNA Clean Beads (Vazyme) and quantified using Qubit and 2100 Bioanalyzer (Agilent). The Ccna2 ...
-
bioRxiv - Biophysics 2023Quote: Drp1 isoform 1 (Genbank accession number AB006965) was PCR amplified with Pfu Turbo DNA polymerase (Stratagene, La Jolla, CA) as an NdeI/XhoI fragment ...
-
bioRxiv - Neuroscience 2023Quote: ... nucleotides 214–990) was amplified by PCR and cloned into the pBluscript II KS (−) plasmid (Stratagene, La Jolla, CA). Antisense RNAs were synthesized from linearized plasmids using T3 RNA polymerase (New England Biolabs ...
-
bioRxiv - Genetics 2023Quote: ... The PCR amplifications were performed with Herculase II fusión DNA Polymerase following supplier recommendation (Agilent, Santa Clara, CA, USA).
-
bioRxiv - Genomics 2022Quote: ... The sizes of mRT-PCR products were evaluated and amplicons were quantified on a TapeStation device (Agilent, CA, USA). Equal amounts of RT-PCR products from two reactions per sample were pooled together for downstream NGS library preparation and sequencing.
-
bioRxiv - Microbiology 2023Quote: ... Real-time Polymerase Chain Reaction (qPCR) was conducted in a Stragene Mx3005P real-time PCR system (Agilent Technologies®) to analyze the relative expression of the cytokine genes Interleukin 2 (IL-2) ...
-
bioRxiv - Neuroscience 2023Quote: ... The cDNA content of pre-fragmentation and post-sample index PCR samples was analyzed using the 2100 BioAnalyzer (Agilent). Sequencing libraries were loaded on an Illumina NovaSeq flow cell at VIB Nucleomics core with sequencing settings (Supplementary Table 3 ...
-
bioRxiv - Cancer Biology 2023Quote: ... Each deletion or mutant was produced by PCR using Pfu Ultra Ⅱ Fusion HS DNA Polymerase (Agilent Technology 600670). Vectors were transfected into T7 Express lysY Competent E ...
-
bioRxiv - Biophysics 2024Quote: ... The PCR product was digested overnight with DpnI at 37°C and transformed into XL1-Blue Supercompetent cells (Agilent) and the mutation was confirmed by sequencing (Eurofins Genomics) ...
-
bioRxiv - Plant Biology 2024Quote: ... and qRT–PCR experiments were performed with the “Brilliant III Ultra-Fast SYBR Green QPCR Master Mix” (Agilent Technologies) according to the manufacturer’s specifications ...
-
bioRxiv - Molecular Biology 2024Quote: All PCR reactions were completed using a 50 ul reaction containing: 0.5 ul PFuUltra II fusion HS DNA Polymerase (Agilent), 1 % PFu Ultra reaction buffer ...
-
bioRxiv - Biochemistry 2024Quote: ... PCR products were purified (AMPure XP system) and library quality was assessed on the Agilent 5400 system(Agilent,USA) and quantified by QPCR (1.5 nM) ...
-
bioRxiv - Cell Biology 2021Quote: ... Hsc70D10N was generated by PCR-based site-directed mutagenesis using the QuikChange II XL Site-Directed Mutagenesis Kit (Agilent Technologies). Cyclin D1 KO was conducted by CRISPR/Cas9 genome editing (Xie et al. ...