Labshake search
Citations for Thermo Fisher :
4751 - 4800 of 6840 citations for H D Glu amc oh since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2022Quote: ... cells were treated with antibodies (100 or 10 nM) for 1 h at 4°C and then stained Alexa647-conjugated goat anti-human IgG (Invitrogen, A21445) for 0.5 h at 4°C ...
-
Pathogenic variants of sphingomyelin synthase SMS2 disrupt lipid landscapes in the secretory pathwaybioRxiv - Cell Biology 2022Quote: Cells were metabolically labeled for 24 h with 4 μM clickable sphingosine in Opti-MEM reduced serum medium without Phenol red (Gibco, 11058). Next ...
-
bioRxiv - Cell Biology 2022Quote: ... the coverslips were incubated at room temperature for 1 h with Alexa fluor 568- conjugated goat anti-rabbit (A11011, ThermoFisher Scientific) or anti-mouse (A11004 ...
-
bioRxiv - Immunology 2020Quote: ... The solution was allowed to mix at room temperature for 1 h and then added to recently washed and dried magnetic protein G Dynabeads (Thermo Fisher). The mixture was incubated for 1.5 h and resin was separated from the supernatant magnetically ...
-
bioRxiv - Microbiology 2021Quote: Complex trypsin-digested peptide mix was first separated by 1 h high performance liquid chromatography (HPLC) gradient using reverse phase C18 columns on an Dionex Ultimate 3000 UPLC (ThermoFisher Scientific) followed by a run on Q-Exactive (ThermoFisher Scientific ...
-
bioRxiv - Microbiology 2020Quote: ... The copy number of AEFV RNA was determined by reverse transcription quantitative polymerase chain reaction (RT-qPCR) based on serial dilution of the AEFV NS4 RNA with Maxima H minus First Strand cDNA Synthesis kit (Thermo Fisher) and Fast SYBR Green Master Mix (Thermo Fisher) ...
-
bioRxiv - Neuroscience 2021Quote: ... and rinsed and then incubated for 2 h with appropriate Alexa Fluor-conjugated secondary antibodies (R37117, Thermofisher, Waltham, MA, 1 : 500). Fluorescent images were acquired using Olympus IX81 or Zeiss 880LSM microscopes.
-
bioRxiv - Neuroscience 2020Quote: ... at 4 ng/μL and then pulled-down for 2 h using protein G-coupled dynabeads (50 μL, Thermo Fisher Scientific). After washing 3 times with 0.3 M NaCl solution ...
-
bioRxiv - Microbiology 2020Quote: ... followed by a 1 h incubation with a 1:3,000 dilution of goat anti-rabbit IgG coupled to HRP secondary antibodies (Thermo Fisher Scientific). Bands were detected by chemiluminescence using ECL Western blotting detection reagent (Amersham Bioscience ...
-
bioRxiv - Microbiology 2020Quote: ... cDNA was synthesized from 300-500 ng of DNAse-treated RNA using the RevertAid H Minus First Strand cDNA Synthesis Kit (Thermo Scientific), following the manufacturer’s instructions for random hexamer primer (IDT ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... Serum samples at varying dilutions were incubated for 2 h followed by detection by a goat anti-human Fc-HRP secondary antibody (ThermoFisher Scientific). The plasma concentration of AvFc was calculated by interpolating from a standard curve ...
-
bioRxiv - Microbiology 2021Quote: ... Typhimurium-infected BMDMs was extracted 2 h post infection using the Qiagen RNAeasy kit and cDNA was synthesized with SuperScript III (Life Technologies) following the manufacturer’s instructions ...
-
bioRxiv - Immunology 2020Quote: PBMC (1-2*10^6 cells) and pDC (1-4*10^4) were maintained for 16 h in RPMI1640+10% FBS+ 1% (PS) (Gibco Laboratories) in 96 well round bottom plates ...
-
bioRxiv - Neuroscience 2020Quote: ... The sections were then incubated with the following secondary antibodies for 3 h at room temperature: anti-rabbit IgG-Alexa488 and anti-rat IgG-Alexa488 (1:1000 for both; Invitrogen Co). Sections were mounted on microscope slides and embedded with Vectashield that includes DAPI for nuclear staining (Vector Laboratories ...
-
bioRxiv - Microbiology 2021Quote: ... the cell monolayer was washed with 1X PBS and fixed for 1 h at room temperature with 10% neutral buffered formalin (ThermoFisher Scientific). Following formalin removal ...
-
bioRxiv - Biochemistry 2020Quote: ... 5 mM 2-mercaptoethanol and incubated for 1 h at 37 °C with 1 mM EDTA (ethylenediaminetetraacetic acid) and RNase A/T1 (ThermoFisher Scientific) (1:100) ...
-
bioRxiv - Immunology 2021Quote: ... or CA-074me for 1 h before challenge with bacteria were washed 3 times with pre-warmed Hanks’ Balanced Salt Solution (HBSS, Thermo-Fisher Scientific) and mROS were stained using 2.0 µM MitoSOX Red (Life Technologies ...
-
bioRxiv - Biophysics 2021Quote: ... Transfected cells were studied in PBS at 37°C for 2 h maximum in an Attofluor cell chamber (Thermo Fisher Scientific).
-
bioRxiv - Microbiology 2021Quote: ... A549 cells in a 12-well format were transfected with 10 pmol of siRNA (Dharmacon; SMART pool against AJUBA, LIMD1 mRNA and a nonspecific control sequence) for 48 h using Lipofectamine RNAiMAX (Life Technologies). Plasmid transfections were performed according to manufacturer’s protocol in 12 -well plates or 4-well Lab Tek II chamber slides (Nunc ...
-
bioRxiv - Microbiology 2021Quote: ... Gels were electrophoresed at 60 °C and 70 V for 16 h and visualized with SYBR Gold staining (Life Technologies, NY). Digital photographs of gel images were analyzed using GelComparII v.5.10 (Applied Maths ...
-
bioRxiv - Neuroscience 2020Quote: ... highly cross-adsorbed AlexaFluor A594 for CD31 and donkey anti-rabbit IgG (H+L) highly cross-adsorbed AlexaFluor A647 for NTSR2 (Life Technologies), diluted in blocking solution at 1:800 ...
-
bioRxiv - Neuroscience 2020Quote: ... coverslips were washed three times in PB 0,12 M under agitation at RT and incubated with goat anti-rabbit IgG (H+L) highly cross-adsorbed AlexaFluor A488 (1:800, Life Technologies) diluted in the blocking solution for 2H ...
-
bioRxiv - Neuroscience 2020Quote: ... The sections were then washed three times in 0.1 M PBS and incubated for 2 h at room temperature in donkey anti-goat AlexaFluor546 (1:500, Invitrogen, #A-11056), donkey anti-goat FITC (1:500 ...
-
bioRxiv - Bioengineering 2020Quote: ... samples were fixed with 4% paraformaldehyde (w/v) in PBS for 1 h and stained with Actin Red 555 (Molecular Probes, ThermoFisher) for 1h ...
-
bioRxiv - Neuroscience 2021Quote: ... Membranes were then incubated for 1 h at room temperature with secondary biotinylated antibodies or with the ABC kit (Cat. no. 32020, Thermo Fisher). SuperSignal West Femto (Thermo Scientific Cat n ...
-
bioRxiv - Neuroscience 2022Quote: ... they were incubated for 2 h at RT with an Alexa Fluor 555 nm-conjugated goat anti-mouse secondary antibody (1:500; Molecular Probes, ThermoFisher Scientific cat#A21127 ...
-
bioRxiv - Systems Biology 2022Quote: ... equal amounts of protein lysates were incubated with pull-down antibody overnight at 4°C followed by 2 h treatment with Dynabeads Protein G magnetic beads (10004D, ThermoFisher, MA) for pull down ...
-
bioRxiv - Cancer Biology 2022Quote: ... cDNA was generated from the total RNA by using Maxima H Minus Reverse Transcriptase (200 U/L) according to manufacturer’s protocol (Thermo Fisher Scientific). Quantitative Real-time PCR (qPCR ...
-
bioRxiv - Immunology 2022Quote: ... the cells were washed two times with PBS and incubated for 1 h with CellROX Deep Red Reagent (Invitrogen, Carlsbad, CA) prior to analysis by flow cytometry ...
-
Purkinje cardiomyocytes of the ventricular conduction system are highly diploid but not regenerativebioRxiv - Developmental Biology 2022Quote: ... subsequently with goat anti-mouse IgG (H+L) cross-adsorbed secondary antibody AlexaFluor 488 conjugate 1:1000 (A11001, Thermo Fisher Scientific) to define CMs ...
-
bioRxiv - Developmental Biology 2020Quote: ... overnight at 4°C and further stained with 1:200 Alexa Fluor 633 Goat anti-Rabbit IgG (H+L) Secondary Antibody (Invitrogen A21071) at a 20°C for 3 hours ...
-
bioRxiv - Immunology 2020Quote: ... in PBS/0.5% BSA at room temperature for 2 h and washed in PBS/0.2% Tween-20 at room temperature for 1 h five times before mounting with SlowFade Diamond Antifade Mountant (S36963, Life Technologies).
-
bioRxiv - Developmental Biology 2020Quote: ... The gel was fixed with 40% methanol/10% acetic acid and then stained for 1 h using colloidal coomassie dye G-250 (Gel Code Blue Stain Reagent, Thermo Scientific). After in-gel digestion (Noordstra et al. ...
-
bioRxiv - Genomics 2021Quote: ... The cells were washed and incubated with an Alexa Fluor 488-conjugated secondary antibody (10 μg/mL for 1 h at 37°C; Invitrogen, USA). The cells were finally stained with calcofluor white (5 μg/mL for 1 h at 37°C ...
-
bioRxiv - Neuroscience 2021Quote: ... We used the following secondary antibodies conjugated with Alexa Fluor fluorochromes: 488 goat anti-guinea-pig IgG H+L (catalog #A11073, Invitrogen/ThermoFisher), 555 donkey anti-rabbit IgGs H+L (#A-31572) ...
-
bioRxiv - Systems Biology 2020Quote: ... and then stained at RT for 1 h in 50 µL of the 2nd antibody diluent (Alexa Fluor 546 Goat Anti-mouse IgG, A-11030, Thermo Fisher Scientific Inc. ...
-
bioRxiv - Cell Biology 2020Quote: ... The following secondary antibodies were used: Alexa Fluor 488 goat anti-mouse IgG (H+L) (A-11001, 1:500; Molecular Probes), Alexa Fluor 555 goat anti-rabbit IgG (H+L ...
-
bioRxiv - Molecular Biology 2020Quote: ... The obtained RNA products were converted back to DNA oligo probes via reverse transcription (RT) with common RT primer (ATCGACCCGGCATCAACGCCACGATCAGCT) conjugated with a 5’ AlexaFluor 647 using Maxima H Minus RT enzyme (Thermo Fisher). The intermediate RNA products were removed with NaOH-EDTA solution in 95 °C for 10 minutes and the single strand DNA oligo probes were purified via DNA clean & concentrator-25 (D4033 ...
-
bioRxiv - Physiology 2021Quote: ... or 10 µM SN-401 for 96 h were solubilized in TRIzol and the total RNA was isolated using PureLink RNA kit (Life Technologies). For differentiated adipocytes ...
-
bioRxiv - Immunology 2020Quote: ... Unconjugated primary antibodies were detected with fluorescently labeled species appropriate secondary antibodies including Goat Anti-Rabbit IgG (H+L) Alexa Fluor 594 (ThermoFisher Scientific) and Goat Anti-Rat IgG (H+L)-Alexa Fluor 647 (ThermoFisher Scientific) ...
-
bioRxiv - Cancer Biology 2020Quote: ... was reverse transcribed (RT) to cDNA from random hexamers using the ReverAid H Minus First Strand cDNA Synthesis Kit (Thermo Scientific). Semi-quantitative RT-PCR for RSK elements was performed on the cDNA using the following primers – RSK1 ...
-
bioRxiv - Molecular Biology 2021Quote: ... HeLa cells were first transfected with siRNA for 24 h and then transfected with different plasmids by Lipofectamine 2000 (Invitrogen, 11668019) again ...
-
bioRxiv - Microbiology 2020Quote: ... chamber slides were incubated with secondary antibody Alexa-Fluor 488 goat anti-human IgG (H+L) (Invitrogen #A-11013, Paisley, UK) diluted 1:500 and Hoechst 33342 (Invitrogen ...
-
bioRxiv - Pathology 2021Quote: H&E staining was performed by a standard method using Shandon Instant Hematoxylin and Eosin-Phloxine (Thermo Fisher Scientific, Waltham, MA) multichrome stain ...
-
bioRxiv - Pathology 2021Quote: ... Equal amounts of GST-tagged TaBln1 or GST (negative control) were mixed with TaCam3-His and incubated at 4°C for 2 h with GST beads (Thermo Scientific). The beads were collected and washed five times using the GST Protein Interaction Pull down Kit (Thermo Scientific ...
-
bioRxiv - Cancer Biology 2020Quote: ... and Pierce Goat Anti-Mouse IgG (H+L) peroxidase conjugated goat secondary antibody (Cat # 31430, AB_228307) were purchased from Invitrogen (Waltham, MA). Cy™5 AffiniPure Donkey Anti-Rabbit IgG (H+L) ...
-
bioRxiv - Neuroscience 2020Quote: ... Supernatant was discarded into 2M NaOH and membrane was washed seven times with each 160 µL PBS and blocked 1 h with 160 µL Superblock (Thermo Scientific) prepared in MilliQ ...
-
bioRxiv - Immunology 2021Quote: ... coated overnight at 4⍰°C with 2μg/well SARS-CoV-2 FL-S protein diluted in PBS were washed with PBS/Tween (0.05% v/v) and blocked for 1⍰h with 100⍰μl per well of Blocker Casein in PBS (Thermo Fisher Scientific) at 20⍰°C ...
-
bioRxiv - Immunology 2020Quote: ... and 105.8 mg/mL L-Arginine U-13C6,U-15N2 R10 (CKGAS, #CNLM-539-H-0.25)) prepared in RPMI SILAC media (Thermo Scientific, #88365) supplemented with 10% dialyzed FBS (HyClone ...
-
bioRxiv - Cell Biology 2020Quote: ... The cleared cell lysate was incubated for 2 h at 4 °C in a lysis buffer-equilibrated Ni-NTA column (HisPur Ni-NTA Superflow Agarose, Thermo Scientific, Thermo Fisher Scientific ...