Labshake search
Citations for Thermo Fisher :
4001 - 4050 of 10000+ citations for 2 3 5 6 Tetrahydroxy 4 phosphonooxycyclohexyl dihydrogen phosphate since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2021Quote: ... The eggs were then loaded with the calcium indicator Fura-2 AM (5 μM; Thermo Fisher) for 30 min in KSOM containing 0.02% pluronic F-127 (Thermo Fisher) ...
-
bioRxiv - Neuroscience 2020Quote: ... the drinking water contained thymidine analogue EdU (5-ethynyl-2’-deoxyuridine, Thermo Fisher, cat. no: E10415) to label newly-generated cells ...
-
Control of cortical cytoskeleton-membrane interaction by RhoA regulates peripheral nerve myelinationbioRxiv - Neuroscience 2021Quote: ... the Click-iT EdU (5-ethynyl-2’-deoxyuridine) Alexa Fluor (AF) 568 imaging kit (Molecular Probes) was used in accordance with the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: ... 20 μl RNase A/T1 mix (2 μg μl−1 / 5 U μl−1, Thermo Scientific) was added to 100 μl lysate (OD260 ~ 150 ...
-
bioRxiv - Neuroscience 2020Quote: ... injection of EdU (5-ethynyl-2’-deoxyuridine; Click-it EdU Alexa Fluor 488 imaging kit, Invitrogen) at 5 and 6 days DPD at 50 mg/kg ...
-
bioRxiv - Neuroscience 2020Quote: ... The water contained 1 mg/mL 5-ethynyl-2-deoxyuridine (EdU) (Thermo Fisher Scientific, Cat. # E10187) and 1% sucrose ...
-
bioRxiv - Immunology 2020Quote: ... washed 2 × 100μL with complete RPMI and stained with 5 nM TMRE (T669, Thermo Fisher Scientific) in 200 μL complete RPMI at RT for 20 min ...
-
bioRxiv - Physiology 2021Quote: ... 1-2 µg of vector DNA was mixed with 5 µl of Lipofectamine™ (Thermo Fisher) in OPTIMEM-I media (GIBCO ...
-
bioRxiv - Molecular Biology 2020Quote: ... Primer extension was performed with 2 pmol of DNA gene-specific primers (5’CATGCTTAACGTAATTCAACAGAAATTATATG) by Invitrogen SuperScript III reverse transcriptase ...
-
bioRxiv - Microbiology 2021Quote: ... RT-qPCR detection of SARS-CoV-2 was performed on a QuantStudio 5 instrument (Applied Biosystems) using a TaqPath 1-step RT-qPCR Master Mix (Applied Biosystems ...
-
bioRxiv - Zoology 2020Quote: ... After 2 h and 30 min we added 5 μM dihydrorhodamine-123 (DHR) (Thermo Fisher Scientific) to the cell suspension to stain cells positive for reactive oxygen species (ROS ...
-
bioRxiv - Genomics 2021Quote: ... followed by 2 x 5 min washes in PBS before mounting in Prolong Diamond (Life Technologies).
-
bioRxiv - Immunology 2020Quote: T cells (5×106) from triplicates of 2 independent experiments were lysed in TRIzol reagent (ThermoFisher). Total RNA was isolated per manufacturer’s instruction and resuspended in RNase free water ...
-
bioRxiv - Immunology 2020Quote: Mice were injected intraperitoneally with 0.5 mg 5-ethynyl-2’-deoxyuridine (EdU, Invitrogen or Sigma-Aldrich). For pulse experiments ...
-
bioRxiv - Cell Biology 2022Quote: 200,000 cardiomyocytes were incubated in Amplex Red (5 μM; 2 min) for cellular ROS (A22177, ThermoFisher), or MitoSOX Red (5 μM ...
-
bioRxiv - Immunology 2022Quote: ... 2-5×106 cells were incubated in 15 μl Indo-1 solution in 1ml IMDM (Gibco) + 1%FBS (Sigma ...
-
bioRxiv - Bioengineering 2022Quote: ... RBC (5 million cells/mL) were incubated with 2 μg/mL calcein AM (Thermo Fisher Scientific) for 15 minutes at 37°C ...
-
bioRxiv - Immunology 2023Quote: ... added to 2 μL of TruCut Cas9 Protein v2 (5 ng/μL, Thermo Fisher Scientific A36498), and incubated for 10 minutes at room temperature ...
-
bioRxiv - Neuroscience 2024Quote: ... Cells were loaded with Fura-2 AM at 1 μg/mL (108964-32-5, Life Technologies) in HBSS or Fluo-4 AM at 10 μM in (ThermoFisher ...
-
bioRxiv - Developmental Biology 2023Quote: The medusae were incubated with 150 μM 5-ethynyl-2’-deoxyuridine (EdU) (EdU kit; Invitrogen, C10337) in ASW for 1 h or 24 h ...
-
bioRxiv - Cancer Biology 2023Quote: ... 2 μg of sgRNA plasmid was transfected to PLC/PRF/5 cells using Lipofectamine 3000 (Invitrogen). After 2 days’ culture in DMEM medium ...
-
bioRxiv - Cell Biology 2023Quote: ... TMT reaction was allowed for 2 hours and quenched with 5% hydroxylamine (90115, Thermo Fisher Scientific). All the samples were pooled and dried in a SpeedVac (EP022822993 ...
-
bioRxiv - Bioengineering 2023Quote: A 5-ethynyl-2′-deoxyuridine (EdU) incorporation assay was performed according to the manufacturer’s protocol (Invitrogen). Briefly ...
-
bioRxiv - Genetics 2023Quote: RNA was extracted from 2-5 million HEK293T or U937 cells using TRIzol Reagent (Ambion, 15596018). Genomic DNA was removed using DNA-free DNA removal Kit (ThermoFisher ...
-
bioRxiv - Immunology 2023Quote: ... The tissue was incubated 2 times in RPMI 1640/5%FCS supplemented with 5mM EDTA (Gibco) for 20min each at 37°C and 200rpm ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... per liter] and 20% glycerol on an SM/5 agar media [2 g glucose (Fisher Scientific), 2 g yeast extract (Oxoid) ...
-
bioRxiv - Developmental Biology 2023Quote: ... samples were trapped (PepMap 100 C18, 100 μm × 2 cm, 5 μM particles; Thermo Fisher Scientific) at a flow of 5 µL min-1 of 0.1 % FA ...
-
bioRxiv - Genomics 2023Quote: ... for 2 h and with 33 nM C12FDG (5-Dodecanoylaminofluorescein Di-β-D-Galactopyranoside; ThermoFisher D2893) for 1 h ...
-
bioRxiv - Developmental Biology 2023Quote: ... mice were injected intraperitoneally with 2.5 mg of 5-ethynyl- 2’-deoxyuridine (EdU; Thermo Fisher Scientific). Lungs were harvested ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... per liter] and 20% glycerol on an SM/5 agar media [2 g glucose (Fisher Scientific), 2 g yeast extract (Oxoid) ...
-
bioRxiv - Cancer Biology 2024Quote: A 5-ethynyl-2′-deoxyuridine (EdU) incorporation assay was performed according to the manufacturer’s protocol (Invitrogen). Hydrogel-embedded PCLS were incubated for 16 hours in complete culture media with 10 μM EdU ...
-
β-1,6-glucan plays a central role in the structure and remodeling of the bilaminate fungal cell wallbioRxiv - Microbiology 2024Quote: ... After 16 h incubation at 37°C in a 5% CO2 chamber (Cytoperm 2, ThermoFisher Scientific), the culture supernatants were collected and stored at –20°C until further analysis.
-
β-1,6-glucan plays a central role in the structure and remodeling of the bilaminate fungal cell wallbioRxiv - Microbiology 2024Quote: ... After 24 h incubation at 37°C in a 5% CO2 chamber (Cytoperm 2, ThermoFisher Scientific), the culture supernatants were collected and stored at –20°C until further analysis.
-
bioRxiv - Genetics 2024Quote: ... Fungal nuclei were stained 5 min before imaging with 2 µg/ml Hoechst 33342 (Invitrogen™) in water in the dark ...
-
bioRxiv - Neuroscience 2024Quote: ... Then 2-5 µg of RNA were reverse transcribed using the Superscript III reverse transcriptase (Invitrogen) and oligo dT primer (Invitrogen) ...
-
bioRxiv - Molecular Biology 2024Quote: Unfragmented UHRR or HEK-293T RNAs (5 μg) were DNased with 2 U TURBO DNase (Invitrogen) and purified using an RNA Clean & Concentrator kit (Zymo Research ...
-
bioRxiv - Microbiology 2024Quote: ... tightly synchronised parasites were incubated in 20 μM 5-ethynyl-2-deoxyuridine (EdU, Thermo Fisher Scientific) for 7.5 minutes ...
-
bioRxiv - Biochemistry 2021Quote: ... onto a Dionex IonPac AS11-HC column (2 mm × 250 mm, 4 μm particle size, Thermo Scientific) equipped with a Dionex IonPac AG11-HC guard column (2 mm × 50 mm ...
-
bioRxiv - Biochemistry 2021Quote: ... equipped with a Dionex IonPac AG11-HC guard column (2 mm × 50 mm, 4 μm, Thermo Scientific). The column temperature was held at 30°C ...
-
Mediobasal hypothalamic FKBP51 acts as a molecular switch linking autophagy to whole-body metabolismbioRxiv - Neuroscience 2021Quote: ... onto a Dionex IonPac AS11-HC column (2 mm × 250 mm, 4 μm particle size, Thermo Scientific) equipped with a Dionex IonPac AS11-HC guard column (2 mm × 50 mm ...
-
Mediobasal hypothalamic FKBP51 acts as a molecular switch linking autophagy to whole-body metabolismbioRxiv - Neuroscience 2021Quote: ... equipped with a Dionex IonPac AS11-HC guard column (2 mm × 50 mm, 4 μm, Thermo Scientific). The column temperature was held at 30°C ...
-
bioRxiv - Plant Biology 2020Quote: ... 4 hour incubation in MTSB containing 2 % BSA and 0.5 % Alexa-conjugated anti-mouse secondary antibody (Invitrogen), 9 washes for 15 minutes in MTSB ...
-
bioRxiv - Microbiology 2020Quote: ... The cleared lysate was incubated for 2 h at 4 °C with Ni-NTA agarose resin (Invitrogen) under slight agitation ...
-
bioRxiv - Neuroscience 2021Quote: ... were incubated with 2 μg of total DNA mixed with 4 μl of Lipofectamine 2000 reagent (Invitrogen) following supplier instructions ...
-
bioRxiv - Molecular Biology 2020Quote: ... for 2-hrs before loading into a 4-12% Bis-Tris SDS-PAGE gel (Invitrogen Cat#NP0322BOX). Gels were washed ...
-
bioRxiv - Neuroscience 2021Quote: ... then incubated for 2 hours at 4° C in either DyLight 800 goat anti-rabbit IgG (Invitrogen) or DyLight 800 rabbit anti-mouse IgG (Rockland Immunochemicals ...
-
bioRxiv - Bioengineering 2021Quote: ... buffered with 10mM 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES) (Life Technology, Thermo Fisher Scientific Inc., USA) and coated with 20 μg/mL laminin (Sigma Aldrich ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... stock solutions were made in 25 mM 4-(2-hydroxyethyl)-1-piperazine ethanesulfonic acid (HEPES, Fisher Scientific). The thrombin-selective inhibitor PPACK.2HCl and MMP Inhibitor V (ONO-4817 ...
-
bioRxiv - Plant Biology 2021Quote: ... stratified for 2 days at 4°C and grown for 11 days in a Sanyo (Fisher Scientific) under short-day conditions (8 h light ...
-
bioRxiv - Microbiology 2021Quote: ... Transgenic parasites were selected with 4 nM WR99210 (Jacobus Pharmaceuticals) or 2 μg/ml blasticidin S (Invitrogen). To select for integrants by SLI ...