Labshake search
Citations for Thermo Fisher :
3801 - 3850 of 10000+ citations for 2 3 5 6 Tetrahydroxy 4 phosphonooxycyclohexyl dihydrogen phosphate since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2022Quote: ... Red blood cells were removed by treatment with 3-5 mL of ACK lysis buffer (Gibco, Cat. No. A1049201) and a subsequent washing step in RPMI 1640 with 10% FBS ...
-
bioRxiv - Cell Biology 2020Quote: ... These duplex reactions were run in triplicate (3 wells) on a QuantStudio 5 Real-Time PCR System (Thermo Fisher). One of two duplex assay pairings were used for each experiment ...
-
bioRxiv - Pathology 2020Quote: ... reverse primer 5’-cgaactCCG AGT TTA TAC TGC CCA GTT CG-3’ with FAM-labeled LUX (Cat. no19450335, Invitrogen). The mouse Vascular Endothelial Growth Factor assay ...
-
bioRxiv - Immunology 2020Quote: ... and reverse primer ENVN (5’ - TGCCAATCAGGGAAAAAGCCTTGTGTG - 3’. The envelope amplicons were purified, and ligated into pcDNA3.1D/V5-His-TOPO vector (Invitrogen). Chimeric envelope pseudoviruses were generated by swapping the V1V2 ...
-
bioRxiv - Genetics 2020Quote: ... Samples (5 μL each) were loaded into wells of a NuPAGE Tris-acetate 3 – 8% polyacrylamide gel (ThermoFisher Scientific) and electrophoresed for 60 min at 15 volts/cm ...
-
Molecular architecture determines brain delivery of a transferrin-receptor targeted lysosomal enzymebioRxiv - Neuroscience 2021Quote: ... Sections were rinsed in 1xPBS/0.05% Tween for 3 rounds of 5 minutes followed by incubation in secondary antibody (Invitrogen: Goat anti-rat Alexa Fluor 555 ...
-
bioRxiv - Cancer Biology 2021Quote: ... LDHC expression was quantified by specific 5′FAM-3′MGB Taqman gene expression primer/probe sets (Hs00255650_m1, Applied Biosystems). MAP1B expression was quantified using primers for SYBR-based qPCR (F ...
-
bioRxiv - Molecular Biology 2021Quote: ... and Il36A_rev (5′-CAGTTCTTGGGTCAGAATGAGTG-3′) and subsequent cloning into pJET1.2/blunt vector as described by the manufacturer (ThermoFisher Scientific). The DNA fragment encoding mouse C/EBPβ residues 221–296 (bZIP domain ...
-
bioRxiv - Genomics 2021Quote: ... 0.5μM oligo-dT (IDT; 100uM 5′-biotin-ACGAGCATCAGCAGCATACGA-T30VN-3′) and 0.5mM dNTPs/each (Thermo Fisher; 25 mM each) and snap frozen at −80 °C ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... The full structure of the NUKU2 transcript was determined with 5’ and 3’ RACE using the GeneRacer kit (Invitrogen), and testicle total RNA (Ambion ...
-
bioRxiv - Bioengineering 2022Quote: ... organoids were washed 3 times for 5 minutes each using PBS and mounted on glass microscope slides (Fisher Scientific). 90 μm Polybead Microspheres (Polyscience ...
-
bioRxiv - Immunology 2023Quote: ... Following preset incubation times (0, 0.5, 1, 3, or 5 h) cells were harvested by trypsinization (500 μl TrypLE, Gibco) for 5 min at 37 °C ...
-
bioRxiv - Cancer Biology 2023Quote: ... the sample was washed 3 x 5 min with PBS and mounted in Fluoromount-G (ThermoFisher, 00-4958-02). 15 samples per genotype were prepared and photographed using a tile scan at a confocal microscope Zeiss LSM780 (Zeiss ...
-
bioRxiv - Cell Biology 2023Quote: ... boiled at 95°C for 5 min and loaded into a NuPAGE 3-8% Tris-Acetate Gel (Thermo Scientific) along with HiMark™ Pre-stained Protein Standard (Thermo Scientific LC5699) ...
-
bioRxiv - Immunology 2023Quote: ... Slides were washed extensively (3 x 5 mins) in TBS-tween20 and incubated in appropriately labeled secondary antibodies (Invitrogen) for 1 h at room temperature ...
-
bioRxiv - Cell Biology 2023Quote: HEK293 (ATCC CRL-1573) and HEK239A ΔGRK2/3/5/646 were cultured in Dulbecco’s modified Eagle’s medium (DMEM, Gibco 1196511) supplemented with 10% FBS (Hyclone SH30910.03) ...
-
bioRxiv - Neuroscience 2023Quote: ... Zebrafish embryos were injured at 3 dpf and placed in 5 ug/mL acridine orange (ThermoFisher, Cat. No. A1301) diluted in egg water for 20 minutes ...
-
bioRxiv - Cancer Biology 2022Quote: ... 3.125 µM Oligo-dT30VN (IDT, 5′-AAGCAGTGGTATCAACGCAGAGTACT30VN-3′) and 1:600,000 ERCC RNA spike-in mix (Thermo Fisher, 4456740)) into 384-well hard-shell PCR plates (Biorad HSP3901 ...
-
bioRxiv - Cell Biology 2024Quote: ... 0,5µM Smartseq3 OligodT30VN (IDT; 5’-Biotin-ACGAGCATCAGCAGCATACGAT30VN-3’) adjusted to RT volume and 0,5mM dNTPs/each (Thermo Fisher, #R0181). After cell sorting lysis plates were centrifuged before storage at -80°C ...
-
bioRxiv - Microbiology 2024Quote: ... falciparum (3D7, Dd2, and HB3) parasites were cultured in 3-5% human O+ RBCs in RPMI-1640 (Gibco, 110875093) complete medium containing 0.5% Albumax-II (Invitrogen) ...
-
bioRxiv - Molecular Biology 2023Quote: The cDNAs encoding MpRBOHB and its variants with 3 × FLAG tag at their 5’-end were cloned into the pcDNA3.1(-) vector (Invitrogen) for the quantitative measurement of ROS in HEK293T cells.
-
bioRxiv - Immunology 2022Quote: ... PBMCs were cultured at 37°C with 5% CO2 for 3 days in RPMI-1640 medium (Thermo Fisher Scientific) supplemented 10% FCS (Thermo Fisher Scientific ...
-
bioRxiv - Neuroscience 2022Quote: ... Slides were rinsed 3 x 5 min and cell nuclei were labeled by DNA staining using Hoechst (Life Technologies) for 30 min at RT ...
-
bioRxiv - Genomics 2023Quote: ... in condΔEXP168 were maintained in 3% hematocrit in human O+ blood in RPMI 1640 supplemented with 5% Albumax-II and 50µg/ml hypoxanthine (Gibco), 25mM HEPES (Sigma ...
-
bioRxiv - Developmental Biology 2023Quote: ... 1×3–5 min with 1x PBS + 1 ng/mL DAPI and mounted in ProLong Gold antifade reagent (Invitrogen).
-
bioRxiv - Physiology 2024Quote: ... the peptides were concentrated on an Accalaim μ-Precolumn (0.5 mm × 3 mm, particle size 5 μm; Thermo Scientific) in the isocratic mode at a 10 μL/min flow for 5 min in the mobile phase C (2% acetonitrile ...
-
bioRxiv - Neuroscience 2024Quote: ... animals were incubated for 5 min in TO-PRO-3 Iodide (642/661) (Invitrogen, cat#T3605, 1:1000 dilution). And last ...
-
bioRxiv - Neuroscience 2024Quote: ... cells were washed 3×5 minutes and then mounted on Superfrost Plus slides (Fisher Scientific, Inc., Hampton, NH, USA), and cover-slipped with anti-fade medium (0.5% polyvinyl alcohol-DABCO ...
-
bioRxiv - Neuroscience 2024Quote: ... washed 3 x 5 min in PBS at RT and then incubated with Hoechst 33342 (1:5000, Invitrogen, H3570) in PBS for 30 min at RT ...
-
bioRxiv - Microbiology 2024Quote: ... and flushed 3 times with 5 ml of PBS supplemented with protease inhibitor (Pierce Protease Inhibitor Mini, Thermo Scientific). Debris was removed from the lavage by centrifugation at 1048 x g for 5 minutes ...
-
bioRxiv - Biochemistry 2024Quote: ... at a cell density of 3 to 5 × 106 cells/mL in 30 mL of Expi293 Expression Medium (ThermoFisher) in a humidified atmosphere containing 8% CO2 and shaking at 125 rpm ...
-
bioRxiv - Bioengineering 2024Quote: ... organoids were washed 3 times for 5-min each using PBS and mounted on glass microscope slides (Fisher Scientific). 90 μm Polybead Microspheres (Polyscience ...
-
bioRxiv - Bioengineering 2024Quote: ... Lipid films were rehydrated in 5 mL C4F10 saturated PBS and DiD (1,1’-dioctadecyl 3,3,3’,3’-tetramethylindodicarbocyanine perchlorate; D307, Thermo Fisher Scientific) lipid dye was added when fluorescent MBs were desired ...
-
bioRxiv - Cancer Biology 2024Quote: LDHC expression was quantified using specific 5′FAM-3′MGB Taqman gene expression primer/probe sets (Hs00255650_m1, Applied Biosystems). PD-L1 ...
-
bioRxiv - Biochemistry 2020Quote: ... Samples were run on 6% TBE gel in 1 x TBE (150 V, 90 min, 4°C) stained with SYBR Gold (Thermo Fisher Scientific. S11494) and InstantBlue Protein Stain (Expedeon).
-
bioRxiv - Genetics 2023Quote: ... and heart from 6 wild-type crucian carp at 4-month-age were dissected for total RNA extraction using Trizol (Thermo Fisher, CA, USA). RNA quality was measured using Nanodrop 8000 (Thermo Fisher ...
-
bioRxiv - Biophysics 2020Quote: All the in vitro transcription experiments were performed in NEB’s transcription buffer (40 mM Tris-HCl, 6 mM MgCl2, 1 mM DTT, 2 mM spermidine) with 1 mM NTPs (R1481, Thermo Scientific), 22 wt% glycerol ...
-
bioRxiv - Bioengineering 2020Quote: Each gel electrophoresis reaction used 6 µL of unbound B56 protein-antibody complex and 2 µL of 4x SDS-PAGE sample buffer (Thermo Fisher). After heating the samples to 95 C for 10 minutes ...
-
bioRxiv - Molecular Biology 2022Quote: ... Transfection of 2 µg pSpCas9-BB-2A-GFP-sgYBX1 was carried out with 6 µl of Lipofectamine 2000 (Thermo Fisher Scientific) following manufacturer’s instructions ...
-
bioRxiv - Genetics 2022Quote: ... Cells (1-2.5 x106/mL) were then cultured at 37 °C ex vivo for 2-6 hours in RPMI (Gibco, 21875-034) containing 10% FCS (IGC Technical Services ...
-
bioRxiv - Molecular Biology 2022Quote: ... 500ng circRNAs per well for 24-well plates (2 μg for 6-well plates) were transfected with lipofectamine MessengerMax (Invitrogen, LMRNA003) on the next day when the cell culture must have >90% viability and be 70% confluent ...
-
bioRxiv - Immunology 2021Quote: The Fab fragments of Clone 2 and Clone 6 were generated from full length IgGs of Clone 2 and Clone 6 using a commercial PierceTM Fab Preparation Kit (Thermo Fisher). All procedures were performed following the manufacturer’s instructions ...
-
bioRxiv - Genomics 2021Quote: ... Reporter plasmids (2 μg) were transfected into HEK-293 cells in 6-well plates at ∼60-90% confluency using Lipofectamine 3000 (ThermoFisher Scientific). Cells were harvested after 1 day by aspirating the media and resuspending the cells in 1 mL Trizol reagent (ThermoFisher Scientific) ...
-
bioRxiv - Microbiology 2021Quote: ... CAS number: 328–42–7), 2-Ketoglutaric acid, disodium salt, dehydrate (>99%, CAS number: 305–72–6) were purchased from Acros Organics, Belgium ...
-
bioRxiv - Molecular Biology 2021Quote: ... cells were transfected using 1-2 µg of pMX-GFP or pMX-53BP1 vectors and 6 µL Lipofectamine 2000 (Thermo Scientific). The media was changed after 3 hours of incubation ...
-
bioRxiv - Neuroscience 2023Quote: ... at 1,000g for 2 min and then immediately loaded into the QuantStudio 6 and 7 Flex real-time PCR system (ThermoFisher Scientific). A two-step cycling protocol was implemented to collect cycle threshold (Ct ...
-
bioRxiv - Molecular Biology 2023Quote: ... SVG-A Notch2-HaloTag cells were transfected in 6 well plate format with 2 µg of DNA per well using Lipofectamine 2000 (ThermoFisher Scientific) according to the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2023Quote: ... Protein pellets were resuspended in urea buffer (6 M urea, 2 M thiourea, 100 mM ammonium bicarbonate, pH 8.0) and quantified using EZQ (Invitrogen/Life Technologies).
-
bioRxiv - Cancer Biology 2023Quote: ... a dry transfer was completed at 30V for 6 min with PVDF stacks in an iBlot 2 transfer instrument (Thermo Fisher). After gel transfer ...
-
Pyruvate kinase M2 regulates Japanese encephalitis virus replication by interacting with NS1 proteinbioRxiv - Microbiology 2024Quote: ... Neuro-2a cells were cultured on 6-well plates and then transfected with a total of 2 µg of an expression plasmid using Lipofectamine 2000 (Invitrogen, USA) as per the instructions provided by the manufacturer.