Labshake search
Citations for Thermo Fisher :
351 - 400 of 10000+ citations for 3 O tert Butyldimethylsilyl 24 ethyl 24 phenylsulfonyl cholest 5 ene 3 ol d7 since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2021Quote: ... utilizing 24-well culture plates (Nunc™, ThermoFisher, USA). Briefly ...
-
bioRxiv - Microbiology 2021Quote: ... utilizing 24-well culture plates (Nunc™, ThermoFisher, USA). Briefly ...
-
bioRxiv - Cancer Biology 2021Quote: ... anti-TNC (BC-24, 1:4000 dilution, ThermoFisher Scientific) or anti-TNFα (AF-410 ...
-
bioRxiv - Biochemistry 2021Quote: ... DNA was extracted after 24 h using DNAzol (Invitrogen) according to manufacturer’s instructions ...
-
bioRxiv - Bioengineering 2021Quote: ... and 24-well plates were purchased from Thermo Fisher.
-
bioRxiv - Biophysics 2021Quote: ... Glass coverslips (24×60 mm) from Thermo Scientific (BB02400600A113FST0). Ammonium hydroxide solution from SIGMA (221228) ...
-
bioRxiv - Microbiology 2020Quote: 24 well flat-bottomed cell culture plates (Thermo Scientific) were seeded with 3.0 x 105 /ml Vero E6 cells in 0.5 ml volumes of 2 x MEM medium containing Glutamax (2 x MEM Gibco ...
-
bioRxiv - Immunology 2021Quote: ... and Lcn2 (24 h post stimulation, Cat # EHLCN2, Invitrogen).
-
bioRxiv - Microbiology 2021Quote: ... thaliana seedlings in a 24-well plate (Thermo Scientific), each well contained four seedling ...
-
bioRxiv - Microbiology 2021Quote: ... thaliana seedlings in a 24-well plate (Thermo Scientific), each well contained four seedling ...
-
bioRxiv - Systems Biology 2022Quote: ... 24 mL of DMEM/F12 medium (Invitrogen/Life Technologies) supplemented with 0.5 mL of 1% penicillin and streptomycin (Life Technologies) ...
-
bioRxiv - Systems Biology 2022Quote: ... 24 mL of DMEM/F12 medium (Invitrogen/Life Technologies) supplemented with 0.5 mL of 1% penicillin and streptomycin (Life Technologies) ...
-
bioRxiv - Cancer Biology 2023Quote: ... in a 24 well plate (ThermoFisher 12-556-006) and grown in 500 µL MOM media added into each well ...
-
bioRxiv - Physiology 2022Quote: ... laminin [(1:200, #PA1-16730, Invitrogen; Waltham, MA; (24)] ...
-
bioRxiv - Neuroscience 2022Quote: ... with 24×50-1.5 microscope cover glass (Fisher Scientific).
-
bioRxiv - Neuroscience 2024Quote: ... 24% (v/v) Hanks’ balanced salt solution (HBSS, Gibco), 24% (v/v ...
-
bioRxiv - Biochemistry 2023Quote: ... 24 on a Titan Krios electron microscope (Thermo Fisher) at 300 kV with a Quantum energy filter (Gatan ...
-
SPNS1 is required for the transport of lysosphingolipids and lysoglycerophospholipids from lysosomesbioRxiv - Biochemistry 2022Quote: ... After 24 hours of transfection using lipofectamine 2000 (Invitrogen), single cells were sorted by flow cytometry onto 96-well plates ...
-
bioRxiv - Microbiology 2023Quote: ... berghei 24 hours pbf using the TRIzol reagent (Invitrogen). The RNA was used to generate cDNA that was subsequently used in the amplification of CTL4 using primers P51/P52 with T7 overhangs to produce double-stranded RNA using the T7 high yield transcription kit (ThermoFisher) ...
-
bioRxiv - Molecular Biology 2023Quote: ... 24 hours after plating using Lipofectamine 3000 (ThermoFisher Scientific) as per manufacturer’s instructions ...
-
bioRxiv - Genomics 2024Quote: ... 0.5ml of phenol:chloroform:isoamyl (25:24:1 mixture, Thermo Scientific) was added together with glass beads (Sigma) ...
-
bioRxiv - Neuroscience 2024Quote: ... 24 µL of Syto16 (Thermo Fisher Scientific Inc., S7578), 40 µL of goat anti-ChAT antibody (MilliporeSigma ...
-
bioRxiv - Molecular Biology 2024Quote: ... For the first 24 h the RevitaCell Supplement (Gibco) was added to the medium ...
-
bioRxiv - Physiology 2024Quote: ... for 24 h and then N2B27 medium (Life Technologies) plus 8 µM CHIR99021 (Selleck Chemicals ...
-
bioRxiv - Physiology 2024Quote: ... using FastPrep-24 (ThermoFisher Scientific, 4×25Hz, 30 sec). Protein extracts were incubated on ice for 10 min and placed in a sonicator water bath filled with ice for 10 min ...
-
bioRxiv - Genomics 2024Quote: ... for 24 h and then N2B27 medium (Life Technologies) plus 8 µM CHIR99021 (Selleck Chemicals ...
-
bioRxiv - Cell Biology 2024Quote: ... at least 24 hours in advance and laminin (Gibco 23017-015 ...
-
bioRxiv - Genetics 2024Quote: ... with 16-24 µg of mouse Cot1 DNA (Invitrogen) and 10 µg salmon sperm DNA ...
-
bioRxiv - Developmental Biology 2022Quote: ... or DNAH9 (Primer; Sense: 5’-ACAGGCTGGTGCTGCAGGA-3’, SP6-antisense: 5’-gcgatttaggtgacactatagCAAAATGACGCTGGAGGGG-3’) using the mMESSAGE mMACHINE™ SP6 Transcription Kit (Invitrogen, ThermoFisher Scientific, MA, USA) and a dig-dNTP mix (Roche ...
-
bioRxiv - Biochemistry 2023Quote: ... cyriacigeorgica clinical isolate responsible for pulmonary nocardiosis was used as a template for polymerase chain reaction (PCR) with primers 5’- gatatgcaccacggcctgca-3’ and 5’-acggcgacgaagaagcgga-3’ by using Invitrogen™ Platinum SuperFi II DNA Polymerase (Thermo Fisher Scientific, Illkirch, France). A second PCR was performed on the aforementioned amplicon to amplify the truncated version of NCY-1 with the following forward 5’-ggtaccgagaacctgtacttccagggttcggccgtggccgatccccggttcgccgcactggaaacg-3’and reverse 5’- gtggtgctcgagctaaccgagcacgtcgacgaccgtcctggtcgcgtcggc-3’primers ...
-
bioRxiv - Microbiology 2024Quote: ... The 16S rRNA gene sequence was amplified with a DreamTaq polymerase using genomic DNA as the template and the primers 08F (5′-AGAGTTTGATCCTGGC-3′) and 1504R (5′-TACCTTGTTACGACTT-3′) following the standard instructions of the manufacturer (Thermo Fisher Scientific, Waltham, MA, USA). The PCR product was purified using the Master Pure Complete DNA & RNA Purification Kit (Epicentre ...
-
bioRxiv - Microbiology 2021Quote: ... which was boiled in the SDS loading buffer with 5% β-mercaptoethanol (Cat. #60-24-2, Acros Organics). The denatured protein samples were separated by Novex™ WedgeWell™ 4-20% SDS-PAGE Tris-Glycine gel and transferred to PVDF membrane (iBlot™ 2 Transfer Stacks ...
-
bioRxiv - Molecular Biology 2020Quote: ... 5% CO2 for 24 h before transient transfection with plasmids encoding Affimer-His constructs using Lipofectamine 2000 (ThermoFisher), as per the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: ... WT cells were stained directly in the 24 well plate with 5 ng/ml FM4-64 (Thermo Fisher) dye ...
-
bioRxiv - Cell Biology 2023Quote: ... After 24 h or 72 h incubation at 37 °C and 5% CO2 in the incubator (Cytomat, ThermoFisher), 25 µl CellTiterGlo® (Promega ...
-
bioRxiv - Cell Biology 2023Quote: ... The carboxyl groups on the bead surfaces were functionalized with amine-reactive groups via N- ethyl-N’-(3-(dimethylamino)propyl)carbodiimide (EDC) and sulfo-N-hydroxysuccinimide (sulfo-NHS, Thermo Fisher) crosslinking for 20 minutes at 4°C ...
-
bioRxiv - Biophysics 2021Quote: ... at a ratio of 1:1.5:1.75:2 (FAM155A-3×FLAG:NALCN-1077-3×HA-GFP:UNC79-3×FLAG:UNC80-3×FLAG) using Lipofectamine 3000 (Thermo Fisher Scientific) and incubated for 40-48 hours ...
-
bioRxiv - Cell Biology 2023Quote: ... Cells were sorted in 96-well plates (Piko PCR Plates 24-well, Thermo Scientific, SPL0240 and Plate Frame for 24-well PikoPCR Plates, Thermo Scientific, SFR0241). Each well contained Triton-X100 (0.2% ...
-
bioRxiv - Zoology 2020Quote: ... This extended COI fragment was amplified using the dgLCO1490 (5’-GGT CAA CAA ATC ATA AAG AYA TYG G-3’) and COI-R1 (5’-TGT TGR GGG AAA AAR GTT AAA TT-3’) degenerate primers (synthesized by Invitrogen) from Meyer et al ...
-
bioRxiv - Cell Biology 2021Quote: ... The Stim coding sequence was cloned by PCR using primers 5’-CAC CAT GCG AAA GAA TAC CAT TTG GAA C-3’ and 5’-TTC CGT GGC AAG CAG CGA AAA GTT C-3’ and ligated into pENTR/D-TOPO (Invitrogen). Site-directed mutagenesis (Stratagene QuikChange XL ...
-
bioRxiv - Biochemistry 2023Quote: ... coverslips were silanized in a 3:5:100 mixture of (3-Aminopropyl)triethoxysilane (APTES) (Fisher Scientific UK, Cat. No. 10677502), acetic acid ...
-
bioRxiv - Developmental Biology 2023Quote: ... Pax9 was cloned from 24 hpf cDNA using the primers pax9F 5’-TCTAGAATGGAGCCAGCCTTT-3’ and pax9R 5’-ATGGATCCTCATAGAGCTGAAGCCACCAG-3’ (Supplementary Table 6) and cloned by TOPO-TA to the pCRII vector (Invitrogen) to create pCRII pax9 ...
-
bioRxiv - Cell Biology 2023Quote: ... with 5’-GGTTTGGGGCTGGGCAT-3’ and 5’-AGGTGCAGCAGCAGTACG-3’ primers (Guillen-Samander et al., 2022) and cloning with the TOPO TA Cloning Kit (Invitrogen).
-
bioRxiv - Cell Biology 2022Quote: ... 5’-AACGGGAAGCTTGTCATCAA-3’) (Berg et al., 2019) or telomeres (Telo, 5’-UUAGGGUUAGGGUUAGGGUU-3’) (McCaffrey et al., 2017) were transfected using RNAiMAX (Invitrogen). In brief ...
-
bioRxiv - Synthetic Biology 2024Quote: ... the full volume of media in each well was pipetted gently 4-5 times and added to 1 mL of FACS buffer containing 3 uM DAPI (PBS pH 7.4, 2–5 mM EDTA, 0.1% BSA, 3 uM DAPI (Thermo Scientific #62247)) ...
-
bioRxiv - Microbiology 2022Quote: ... and a shorter fragment from the C terminus of NSP3 ORF to 3’UTR region was amplified with the primer pairs NSP3 C termF 5’ CATTGCACGCTTTTGATGACTTAG 3’ and NSP3_3’UTR 5’GGCCACATAACGCCCCTATAG 3’ similarly using Superscript III One-Step RT-PCR System with Platinum Taq DNA polymerase (Invitrogen). Amplified PCR products were resolved by electrophoresis on 0.8% agarose gels in Tris-acetate-EDTA buffer ...
-
bioRxiv - Biochemistry 2024Quote: ... 5’-aagaattggagggaccaccccc-3’ (underline is the codon change T to R) and 5-tgtcacgcgctcaaagtggttg-3’ using the fusion DNA polymerase (Thermofisher). After treating the PCR products with DpnI (New England Biolabs ...
-
bioRxiv - Cell Biology 2020Quote: ... Coverslips were washed 3 times in PBS and secondary antibodies (Oregon Green - Thermofisher O-6382, Texas Red – Thermofisher T-6390) diluted in blocking buffer at 1:500 and applied for 2h in the dark at room temperature ...
-
bioRxiv - Cell Biology 2021Quote: ... the tissue was dissolved in 3 ml freshly prepared primary dissociation buffer (collagenase 1 mg/ml, Sigma C6885, in DMEM w/o phenol red, Gibco) and passed through a cut p1000 pipet tip ten times or until smooth passing ...
-
bioRxiv - Biochemistry 2021Quote: ... 1-O-(6-BODIPY®558/568-aminohexyl)-2-BODIPY®FL C5-sn-glycero-3-phosphocholine (Thermo Fisher Scientific) as described previously [38] ...