Labshake search
Citations for Thermo Fisher :
551 - 600 of 10000+ citations for 3 O tert Butyldimethylsilyl 24 ethyl 24 phenylsulfonyl cholest 5 ene 3 ol d7 since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2023Quote: ... DNA was extracted using phenol-chloroform-isoamylalcohol (Invitrogen, 25:24:1) and finally dissolved in 150 μL of 10 mM Tris-HCl (pH 7.5) ...
-
bioRxiv - Cell Biology 2023Quote: ... coated 24 well plates (4EB/well; Fisher Scientific, 08-772-1C) with NK cell differentiation basal media supplemented with 5ng/ml IL-3 (1st week only ...
-
bioRxiv - Microbiology 2024Quote: ... Cells were seeded in 24-well tissue culture treated plates (Nunc) at the following densities ...
-
bioRxiv - Cell Biology 2024Quote: ... and plated in domes in a 24-well plate (ThermoFisher #142475). After 10 minutes of incubation at 37°C ...
-
Development of a genetically encoded sensor for probing endogenous nociceptin opioid peptide releasebioRxiv - Neuroscience 2024Quote: ... 24 hours after transfection cells were disscociated with Versene (Thermo Fisher) and thoroughly washed with PBS ...
-
bioRxiv - Plant Biology 2024Quote: ... DNA was purified using phenol:chloroform:isoamyl alcohol 25:24:1 (Fisher Scientific) and precipitated with GlycoBlue (Invitrogen ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... 24 hours after seeding 2X Fluo-4 direct dye solution (Invitrogen), dissolved in HHBS buffer ...
-
bioRxiv - Molecular Biology 2024Quote: ... 24-well plates were coated with poly-D-lysine (Gibco™) according to manufacturer specifications ...
-
bioRxiv - Biochemistry 2024Quote: ... DNA was then extracted with phenol:chloroform:isoamyl alcohol (25:24:1) (Invitrogen) and isopropanol precipitation following manufacturers recommendation ...
-
bioRxiv - Microbiology 2021Quote: ... FluoZin-3 (FluoZin™-3, AM, cell permeant, Thermo Fisher) was added at 1 mM ...
-
bioRxiv - Biochemistry 2023Quote: ... DiIC12(3) (1,1’-Didodecyl-3,3,3’,3’-Tetramethylindocarbocyanine Perchlorate) (Invitrogen, D383) was used ...
-
bioRxiv - Developmental Biology 2023Quote: ... mounting 3 dpf embryos in 3% methylcellulose (Thermo Scientific, 258111000). After imaging ...
-
bioRxiv - Genetics 2024Quote: ... and/or pAVA2965 [GFP-ENE(WT)-mascRNA] with the Flp recombinase-expressing plasmid pOG44 (Invitrogen). Single colonies of cells with stably integrated Mirror reporters were selected using hygromycin (150-300 µg/mL ...
-
bioRxiv - Microbiology 2021Quote: ... A recombinant lentivirus vector expressing the coding sequence of the EBV transactivator BZLF1 under control of a tetracycline-regulated promoter was constructed by cloning the open reading frame amplified with the primers 5’-CGACCGGTATGATGGACCCAAACTCGAC-3’ and 5’-CGACGCGTTTAGAAATTTAA GAGATCCTCGTGT-3’ into the Age I and Mlu I sites of the pTRIPZ lentiviral vector (Thermo Fisher Scientific, USA). For virus production ...
-
bioRxiv - Developmental Biology 2022Quote: ... 3% FBS (Gibco), 1% MEM non-essential amino acids (Gibco) ...
-
bioRxiv - Microbiology 2021Quote: ... DiOC2(3) (Invitrogen) was added to a final concentration of 30µM or DiSC3(5 ...
-
bioRxiv - Cancer Biology 2022Quote: ... 3% FBS (Invitrogen), 20 ng ml−1 EGF (Peprotech ...
-
bioRxiv - Cell Biology 2020Quote: ... SUMO2/3 (Invitrogen), β-catenin (BD Transduction Laboratories) ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... 3 (Applied Biosystems). We assembled forward and reverse reads using the Geneious (https://www.geneious.com ...
-
bioRxiv - Neuroscience 2023Quote: ... 3% FBS (Gibco), 0.1mM MEM-NEAA (Gibco) ...
-
bioRxiv - Immunology 2024Quote: ... TOPRO-3 (Invitrogen) was added to the staining buffer at a dilution of 1:10000 ...
-
bioRxiv - Microbiology 2021Quote: ... and 2×105 cells were seeded into 24-well culture plates or 5×104 cells into Lab-Tek II 8-well chamber slides (Nunc/Thermo Fisher). To account for donor variations ...
-
bioRxiv - Cancer Biology 2020Quote: ... cells were treated with inhibitors for 24 hours in 96-well plates prior to addition of 50 nM DiIC1(5) (Invitrogen M34151) and 100 uM CCCP (carbonyl cyanide 3-chlorophenylhydrazone ...
-
bioRxiv - Cancer Biology 2022Quote: ... and cultured with PDAC tumor organoids in the lower compartment of the 24-well plate in DMEM containing 5% FBS and 1% penicillin/streptomycin (Thermo Fisher). For IL1α neutralization experiments ...
-
bioRxiv - Cell Biology 2021Quote: Cells were set at a concentration of 1 x105 cells/mL 24 hrs prior to EdU addition (5-ethynl-2’-deoxyuridine; Life Technology, Thermo Scientific) in media free from thymidine prepared using Iscove’s Modified Dulbecco’s Medium (IMDM ...
-
Cytokine and phenotypic cell profiles in human cutaneous leishmaniasis caused by Leishmania donovanibioRxiv - Microbiology 2022Quote: ... Cells were incubated at 37°C in 5% CO2 and monocytes were separated by adherence after 24 hours and cultured in complete RPMI1640(Gibco, USA) supplemented with 5% human heat-inactivated serum (Sigma ...
-
bioRxiv - Microbiology 2022Quote: ... The plates were incubated at 37°C with 5% CO2 for 24 hours in a humidified incubator (Heracell 150i, Thermo Scientific) to allow a lawn biofilm of P ...
-
bioRxiv - Microbiology 2022Quote: Vero cells were infected with each of the indicated viruses at an MOI of 5 for 24 h and lysed with T-PER Tissue Protein Extraction Reagent (Thermo Scientific). The lysates were sonicated and denatured with Glycoprotein Denaturing Buffer (NEB ...
-
bioRxiv - Physiology 2022Quote: ... CD11c+ BM-derived DCs cells were obtained by culturing 5×105 BM cells/well in 24-well plates in RPMI medium (ThermoFisher Scientific) supplemented with 5% serum (Hyclone ...
-
bioRxiv - Immunology 2024Quote: ... with 312,500 B cells for 1 h prior to adding to 24 well plates coated with 5 µg/ml anti-CD3 with or without a permeable polycarbonate cell culture insert (Fisher Scientific) in the presence of 2 µg/mL soluble anti-CD28 ...
-
bioRxiv - Physiology 2023Quote: After 24 h of hyperosmotic stress each well was stained with 5 µg/mL Hoechst 33342 dye (Catalog 62249, Thermo Fisher), 1 µg/mL Propidium Iodide (PI ...
-
bioRxiv - Microbiology 2023Quote: ... 5% CO2 for 24 h before the cells were lysed with 300 µl M-PER Mammalian Protein Extraction Reagent (Thermo Scientific). A volume of 10 µl was resolved on a 3-8% Tris Acetate gel ...
-
bioRxiv - Molecular Biology 2023Quote: ... The cells were incubated at 37 °C with 5% CO2 for 24 hours and were washed twice with PBS (Gibco, USA) (RT ...
-
Pathogenic CD8 T cell responses are driven by neutrophil-mediated hypoxia in cutaneous leishmaniasisbioRxiv - Immunology 2023Quote: ... 20 U/mL recombinant human IL-2 at 37°C and 5% CO2 for 24 hours in RPMI 1640 (Gibco, Canada) containing 100 Units of penicillin and 0.1 mg/mL of Streptomycin (Sigma ...
-
bioRxiv - Cancer Biology 2024Quote: ... cell suspension was filtered through 100 µm cell strainers and washed three times with Ca2+Mg2+ free-HBSS before counting alive cells and kept in culture (37 °C, 5% CO2) for 14 days in a tissue culture treated 24-well plate (ThermoFisher Scientific) until REP stage in TIL-RCM ...
-
bioRxiv - Microbiology 2024Quote: ... MHV68-MR-infected, or MHV68-R443I-infected MC57G cells (MOI=5, 24 h) in biological triplicate using miRVANA isolation kits (Thermo Fisher) and was used for generating OTTR-seq libraries20 ...
-
bioRxiv - Immunology 2024Quote: ... CHO cells were seeded at a density of 3 × 104 cells per well in a 96-well microtiter plate and incubated for 24 hours at 37°C with 5% CO2 in Ham’s F-12K medium (Thermo Fisher #21127022) supplemented with 10% heat-inactivated fetal bovine serum (HI FBS ...
-
bioRxiv - Genetics 2024Quote: ... Two modes of FSFS induction were used to demonstrate fragility at 9p21.2: i) 24 hours with 0.1 µM 5-fluorodeoxyuridine (FUdR) or ii) 14 days with Media 199 (Gibco, Cat #: 11150-059) supplemented with 2% FCS ...
-
bioRxiv - Bioengineering 2024Quote: ... media containing lentivirus was replaced with fresh media and cells were allowed to recover for another 24 hours before starting selection with 2 μg/mL puromycin for 5 days (Gibco, A1113803).
-
bioRxiv - Bioengineering 2023Quote: ... and tert-butyl hydrogen peroxide (ThermoFisher) were used as standards for the extra- and intracellular assays ...
-
bioRxiv - Microbiology 2023Quote: ... tert-Butyl hydroperoxide (tBOOH – Acros Organics) and diamide (Sigma-Aldrich ...
-
bioRxiv - Immunology 2024Quote: ... Tert-Butyl hydroperoxide (TBT) (Acros Organics) was used as a positive control to induce oxidative stress.
-
bioRxiv - Immunology 2021Quote: ... on the QuantStudio 5 or QuantStudio 3 Real-Time PCR System (ThermoFisher Scientific). Relative transcript levels were normalized to TATA-binding protein (Tbp ...
-
bioRxiv - Molecular Biology 2021Quote: ... and CAF-1 p60 (5′-AAUCUUGCUCGUCAUACCA-3′) were transfected using RNAi MAX (Invitrogen).
-
bioRxiv - Neuroscience 2020Quote: ... and 0.175 g/ml 5-bromo-4-chloro-3-indolyl-phosphate (BCIP) (Invitrogen). Alkaline phosphatase staining reaction was proceeded o/n at RT ...
-
bioRxiv - Genomics 2020Quote: ... or a positive control probe 5’-5Alexa488N/(ATA)8TUU (ATA)7-3’ (Invitrogen). Reactions were incubated in a water bath at 37°C for 2 hrs ...
-
bioRxiv - Molecular Biology 2020Quote: ... and 5 mM succinimidyl 3-(2-pyridyldithio)propionate (SPDP) (Thermo Fisher Scientific, USA) in PBS (Thermo Fisher Scientific ...
-
bioRxiv - Cancer Biology 2020Quote: Non-targeting control (CTRL) (Dharmacon) 5’-UGGUUUACAUGUCGACUAA-3’ KIF18A (Silencer Select s37882 – Ambion)8 5’-UCUCGAUUCUGGAACAAGCAG-3’ RAD51 (Silencer Select s11735 – Ambion ...
-
bioRxiv - Bioengineering 2021Quote: ... or siRNA targeting CTNNB1 (siCTNNB1, targeting sequence 5′- CCACAGCUCCUUCUCUGAGUGGUAA -3’, ThermoFisher, Waltham, MA) were resuspended in 50 μL of Opti-MEM and incubated at room temperature for 30 min ...
-
bioRxiv - Immunology 2022Quote: ... and 5 mM succinimidyl 3-(2-pyridyldithio)propionate (SPDP, Thermo Fisher Scientific, USA) in PBS (Thermo Fisher Scientific ...