Labshake search
Citations for Thermo Fisher :
301 - 350 of 10000+ citations for 3 O tert Butyldimethylsilyl 24 ethyl 24 phenylsulfonyl cholest 5 ene 3 ol d7 since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2024Quote: ... coated 24-well plate (Nunc, Thermo Fisher Scientific). After the cells had adhered ...
-
bioRxiv - Biochemistry 2024Quote: ... coated 24-well plate (Nunc, Thermo Fisher Scientific). After the cells had adhered ...
-
bioRxiv - Neuroscience 2023Quote: ... with cover glass (Fisher Scientific 24×50-1.5) using elvanol containing antifade (polyvinyl alcohol ...
-
bioRxiv - Neuroscience 2023Quote: ... and cover-slipped (24×50 mm, Fisher Scientific).
-
bioRxiv - Biophysics 2023Quote: ... 24 × 40 mm microscope cover glass (Thermo Scientific). First ...
-
bioRxiv - Microbiology 2024Quote: ... Plates containing 24 wells (Thermo Scientific™ Nunc™ Non-Treated Multidishes ...
-
bioRxiv - Immunology 2024Quote: ... The *192C*24 plasmid was produced by ThermoFisher.
-
bioRxiv - Neuroscience 2024Quote: ... in a Fisherbrand Bead Mill 24 (Fisher Scientific) for 40 s at a speed setting of 5 in a pre-chilled adaptor tube rack ...
-
bioRxiv - Cell Biology 2024Quote: ... Chloroform/isoamyl alcohol (24:1, Thermo Fisher Scientific) was added ...
-
bioRxiv - Immunology 2021Quote: ... Mice were genotyped by PCR using forward primers 5’-ctgagcagagacccactgaaag-3’ and reverse primers 5’- ggatctggcttctgagtttgtgta-3’ and amplicons were ran in 6% TBE gels (Life Technologies, Carlsbad, CA).
-
bioRxiv - Biochemistry 2021Quote: ... We did this by amplification of the GlyR-FP plasmids using PCR with primers 5’-ATATGGTACCTGGGAGGTCTATATAAGCAGAG-3’ and 5’ATAAGGTACCCCAGGCGGGCCATTTACCGTA-3’ followed by digestion with KpnI (ThermoFisher Scientific, Merelbeke, Belgium) and ligation using instant sticky-end ligase Master mix (NEB ...
-
bioRxiv - Cell Biology 2020Quote: ... 16nM TIMM23 (5’ CCCUCUGUCUCCUUAUUUA 3’, Eurogentech) or 16nM TIM22 (5’ GUGAGGAGCAGAAGAUGAU 3’, Eurogentech) using the Invitrogen Lipofectamine RNAiMAX Reagent (Invitrogen, Carlsbad, CA, USA) diluted with serum-free Gibco Opti-MEM I medium (Gibco ...
-
CRISPR screens for lipid regulators reveal a role for ER-bound SNX13 in lysosomal cholesterol exportbioRxiv - Cell Biology 2021Quote: ... cells were transfected with siRNAs targeting human SNX13 (5’- CAGAAAGGCUCAACAGAAAUU-3’) or SNX14 (5’-GGAUGAAAGUAUUGACAAAUU-3’) using Lipofectamine RNAiMax (Invitrogen, Cat#13778-075) according to the manufacturer ...
-
bioRxiv - Microbiology 2020Quote: ... Approximately 3 kb RT-PCR products covering the S gene deletion were amplified from the viral RNA using the gene specific primers F9newF and F9newR (5’-TAAGGTTGGTGGTAATTATAATTACCTG-3’ and 5’-AAAATAGTTGGCATCATAAAGTAATGGG-3’) and a SuperScript™ IV One-Step RT-PCR System (Invitrogen™, ThemoFisher). A region spanning the deletion was sequenced using primers Wu_24_L and Wu_24_R (5’-TTGAACTTCTACATGCACCAGC-3’ and 5’-CCAGAAGTGATTGTACCCGC-3’).
-
bioRxiv - Molecular Biology 2020Quote: ... 2 µL of 5 mM aa-dUTP/dNTP mix (5 mM each dATP, dGTP and dCTP, 3 mM dTTP and 2 mM 5-(3-aminoallyl)-dUTP (Thermo Fisher Scientific, AM8439)) and 1.25 µL of 40 µM oligo 1 ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... amplified with a set of forward (5’-GAGGGTGAGCTCTCCGAAGGTTGTAG-3’) and reverse (5’-AATTATGAGCTCTGGGAG-TGCGCAAG-3’) primers using DreamTaq DNA Polymerase (Thermo Fisher Scientific, USA). The isolated genomic DNAs were also subjected to amplify full length betasatellites using forward (5’-AGTAAGGGTACCACTACGCTACGCAG-3’ ...
-
bioRxiv - Immunology 2020Quote: ... qPCR for parasite burden was conducted using toxoplasma specific primers: (forward) 5’-TCCCCTCTGCTGGCGAAAAGT-3’ and (reverse) 5’-AGCGTTCGTGGTCAACTATCGATT G-3’ and Power SYBR Green master mix (Applied Biosystems, CA, USA). The qPCR condition settings were ...
-
bioRxiv - Molecular Biology 2022Quote: ... cells were incubated in 2 μM JC-1 (5, 5’, 6, 6’-tetrachloro-1, 1’, 3, 3’-tetraethylbenzimidazolylcarbocyanine iodide, Invitrogen, cat no: T3168) at 37°C for 15 min ...
-
bioRxiv - Molecular Biology 2023Quote: ... 5’ACCATCGCGATAATACGACTCACTATAGGG ACCTCTCTATGGGCA GTCTCCTCTCTATGGCAGTCGACAAA 3’) and RG-5UTR-new-R (5’TCACCGGATAACGGGTTCAATAGAGTTAATTTAATAACTCTATTTGTCGACTGCC ATAGAGAGGAGACTG 3’) and Pfu polymerase (Thermo Fisher Scientific, Waltham, MA, USA). The PCR product was extracted from the gel ...
-
bioRxiv - Microbiology 2024Quote: ... with the primers pZE21-for (5’-GACGGTATCGATAAGCTTGAT-3’) and pZE21-Pbla-rev (5’-GACTCTTCCTTTTTCAATATTATTGAA-3’) and subsequently dephosphorylated using FastAP (Thermo Fisher Scientific, USA). This approach allowed efficient library preparation and screening for mobilized novel resistance determinants ...
-
bioRxiv - Molecular Biology 2023Quote: The RNA of 500 µL iRBCs at 3-5% parasitaemia was isolated using 3 mL TRIzol reagent (Invitrogen) followed by phenol-chloroform phase separation ...
-
bioRxiv - Developmental Biology 2021Quote: ... cells were plated in 24-wells 24 hours prior to lentivirus exposure and RNA lysates were collected 6 days later using TRIzol® (Invitrogen). For Western blotting ...
-
bioRxiv - Cancer Biology 2022Quote: ... 90,000 cells per well were seeded in 24-well plates and after 24 hours the cells were transfected with Lipofectamine LTX and Plus Reagent (ThermoFisher Scientific) along with different combinations of the plasmids according to the experiment ...
-
bioRxiv - Microbiology 2022Quote: ... growth medium (200 µL, 24 h), bacterial cultures (200 µL, 24 h of growth)) and pre-cleaned type 1 glass vials (VOA; Thermo Scientific) were chilled on ice for 10 min ...
-
bioRxiv - Cell Biology 2021Quote: ... medium was replaced 24–48 h after infection and 100 µg/ml Hygromycin (Invitrogen, ant-hg-5) was added.
-
bioRxiv - Microbiology 2021Quote: ... the bottom part which closely fit the microscopy glass slide (24 x 40 mm, #5; Thermo scientific) and contained grooves to guide positioning of the top part precisely above the microfluidic device ...
-
bioRxiv - Cancer Biology 2023Quote: ... Pancreatic tissues were incubated for 24 hours at 4°C in ≥5 volumes of RNAlater solution (ThermoFisher) to preserve RNA integrity ...
-
bioRxiv - Neuroscience 2024Quote: ... Two-phase extraction was performed by adding 400 µl of methyl-tert-butyl ether (MTBE): methanol (3:1, v/v; all solvents of High-performance liquid chromatography (HPLC)-grade (Thermo Fisher Scientific, Germany)) ...
-
bioRxiv - Neuroscience 2020Quote: 20ng of DNA was amplified for PSEN1-Exon6 using forward (5’ GGTTGTGGGACCTGTTAATT 3’) and reverse (5’ CAACAAAGTACATGGCTTTAAATGA 3’) primers with AmpliTaq Gold® 360 PCR Master Mix (Thermofisher, Waltham, MA, USA). Sanger sequencing was performed using BigDye™ Terminator v3.1 Cycle Sequencing Kit (Thermofisher ...
-
bioRxiv - Developmental Biology 2022Quote: ... or DNAH9 (Primer; Sense: 5’-ACAGGCTGGTGCTGCAGGA-3’, SP6-antisense: 5’-gcgatttaggtgacactatagCAAAATGACGCTGGAGGGG-3’) using the mMESSAGE mMACHINE™ SP6 Transcription Kit (Invitrogen, ThermoFisher Scientific, MA, USA) and a dig-dNTP mix (Roche ...
-
bioRxiv - Neuroscience 2022Quote: ... was amplified with specific primers (forward 5’-agtcagaattcatggtgcccactggccag-3’and reverse 5’-AGTCAGGATCCTCAAGCCTTGGCTTCGACTCTT −3’) with fast digest restriction enzymes EcoRl (FD0274, Thermo Fisher Scientific, Massachusetts, USA) and BamHI (FD0054 ...
-
bioRxiv - Neuroscience 2020Quote: ... 5’-GCCTCCCATCCACAAGAATAGTG-3’ and cloned into pCRII-Blunt-TOPO (Invitrogen). This plasmid was then used to generate digoxigenin-labeled sense and antisense probes.
-
bioRxiv - Immunology 2021Quote: ... ENV probe (5’-/VIC/CCTTGGGTTCTTGGGA-3’/MGB, Thermo Fisher Scientific), Gag forward (5’-ATGTTTTCAGCATTATCAGAAGGA-3’) ...
-
bioRxiv - Immunology 2021Quote: ... Pol probe (5’-/NED/AAGCCAGGAATGGATGGCC-3’/MGB, Thermo Fisher Scientific). Thermostabe DNA polymerase was made in-house by transforming E ...
-
bioRxiv - Molecular Biology 2020Quote: ... a control scrambled RNA (customed, Ambion, sense: 5’-UUCUCCGAACGUGUCACGUtt-3’) was used ...
-
bioRxiv - Cell Biology 2020Quote: ... 3-5 minute incubation with Tryple Express Trypsin (Thermo Fisher), and dilution and gentle trituration in complete media ...
-
bioRxiv - Immunology 2021Quote: ... tetramethylindocarbocyanine perchlorate;CILC18(3) (5 µM/mL DiI, ThermoFisher-Invitrogen) and adoptively transferred intravenously into non-myeloablated Lyve1-GFP+ mice ...
-
bioRxiv - Immunology 2021Quote: ... tetramethylindocarbocyanine perchlorate;CILC18(3) (5 µM/mL DiI, ThermoFisher-Invitrogen) and adoptively transferred intravenously into non-myeloablated Lyve1-GFP+ mice ...
-
bioRxiv - Cell Biology 2020Quote: ... TPD53: 5’-GUCUCCAGCAAUAGGAUGAUUUACUA-3’) with Lipofectamine 2000 (Thermo Fisher Scientific) according to the manufacturer’s protocol ...
-
bioRxiv - Immunology 2021Quote: ... and removed by treatment with 3-5 mL trypsin (Gibco) then pelleted by centrifugation at 300 × g for 10 min ...
-
bioRxiv - Microbiology 2024Quote: ... 5’- UUUCCUUCCACUCGGAUAAGAUGCUGA-3’ were transfected with RNAiMaX (Thermo Fisher Scientific) according to the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2024Quote: ... washed 3 x 5 min with PBS (Gibco #14200-067) and fixed with 4 % (w/v ...
-
bioRxiv - Bioengineering 2021Quote: 2.5 x 104 hMSCs were seeded per well in 24 well plates for 24 hours and transfected with Lipofectamine RNAiMAX (ThermoFisher, Waltham, MA) using the manufacturer’s protocol ...
-
bioRxiv - Systems Biology 2023Quote: ... in Expansion Medium without vitamin A (for 50 mL: 24 mL DMEM/F12, 24 mL Neurobasal Medium (21103-049 Thermo Fisher Scientific), 500 µL GlutaMAX ...
-
bioRxiv - Cell Biology 2023Quote: ... 1.5×105 cells were seeded into 24-well plates and transfected after 24 hours with indicated plasmid combinations using Lipofectamine Plus™ Reagent (Invitrogen, 15338030). The total amount of transfected DNA (2 μg DNA per well ...
-
bioRxiv - Cell Biology 2022Quote: ... TcBDF2W92AFw (5’CGACTCCGCTGCGGTTAAAG-3’) and TcBDF2W92ARv (5’-CTTTAACCGCAGCGGAGTCG-3’).The PCR products were first cloned into the pCR2.1-TOPO vector (Invitrogen) and sequenced ...
-
bioRxiv - Biochemistry 2021Quote: ... followed by 10 cycles of 5’ 60 °C -> 5’ 24 °C (HDV cleavage of construct to release pure R3C) and DNAse I treatment (Thermo Scientific, USA). 75-85 nt randomised oligomer was expressed using artificial DNA template (Eurofins Genomics ...
-
bioRxiv - Genetics 2021Quote: ... with 16-24 μg of mouse Cot1 DNA (Invitrogen) and 10 μg salmon sperm DNA ...
-
bioRxiv - Microbiology 2021Quote: ... Cells were incubated with 24 μM FM4-64 (Invitrogen) for 30 min at 4°C ...
-
bioRxiv - Cell Biology 2021Quote: ... Glass coverslips (24×60 mm) from Thermo Scientific (BB02400600A113FST0). Ammonium hydroxide solution from SIGMA (221228) ...