Labshake search
Citations for Thermo Fisher :
3801 - 3850 of 10000+ citations for rno mir 134 RT PCR Primer Set since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2024Quote: ... 40 ng of random hexamer primers (Invitrogen) and 25 pmol of oligo‐dT primer (Invitrogen ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... cDNA synthesized with random primers (Applied Biosystems High-Capacity cDNA reverse transcription kit ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... Primer Express 3.0 (Applied Biosystems, CA, USA) and OligoAnalyzer 3.1 (Integrated DNA Technology ...
-
bioRxiv - Microbiology 2023Quote: ... and random primers (Invitrogen, Waltham, Massachusetts, USA) following the instructions of the manufacturer ...
-
bioRxiv - Neuroscience 2023Quote: ... and Taqman primers were designed by ThermoFisher Scientific ...
-
bioRxiv - Cell Biology 2023Quote: ... qPCR primers were ordered from Life Technologies and are 20-24 bp with a melting temperature of 58-62°C ...
-
bioRxiv - Cancer Biology 2023Quote: ... Taqman primers were purchased from Applied Biosystems and included ...
-
bioRxiv - Cancer Biology 2023Quote: ... TaqMan primer probes were purchased from Thermofisher, Rpl34 (Mm01321800_m1) ...
-
bioRxiv - Cell Biology 2023Quote: ... and oligo(dT)20 primers (Invitrogen, 18418020) using a Takara Thermal PCR Cycler (Takara Bio) ...
-
bioRxiv - Immunology 2023Quote: ... 0.5 µL of Oligo dT primer (Invitrogen/Thermo Fisher ...
-
bioRxiv - Molecular Biology 2023Quote: ... Random Hexamer Primers (48190011, Thermo Fisher Scientific), and RiboLock RNase Inhibitor (EO0384 ...
-
bioRxiv - Cell Biology 2023Quote: ... oligoDT and random hexamer primers (Thermo Scientific), following the manufacturer’s guidelines.
-
bioRxiv - Genomics 2023Quote: ... 0.4uM of forward and reverse primers (Invitrogen), 2.5U of LongAmp Taq DNA Polymerase (NEB ...
-
bioRxiv - Microbiology 2022Quote: ... with random hexamer primers (Thermo Fisher Scientific). The cDNA was used in real-time PCR with PowerUp SYBR Green Master Mix (Thermo Fisher Scientific ...
-
Impact of light pollution at night on male reproductive success in Japanese medaka (Oryzias latipes)bioRxiv - Zoology 2023Quote: ... and 5 µM random hexamer primers (Invitrogen) following the manufacturer’s instructions ...
-
bioRxiv - Bioengineering 2023Quote: ... and Oligo(dT)12-18 primers (ThermoFisher). cDNA was used immediately or stored at 4 °C for no more than 24 hours prior to qPCR.
-
bioRxiv - Immunology 2023Quote: ... Primers for Actb (Mm00607939, Thermo Fisher Scientific), Ifng ([31] ...
-
bioRxiv - Neuroscience 2023Quote: ... All primers were obtained from Invitrogen (Germany) and are listed in table S5.
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... primers for each gene (Thermo Fisher Scientific), and SYBR Premix Ex Taq II (Takara Bio Inc. ...
-
bioRxiv - Developmental Biology 2023Quote: ... in combination with random primers (Invitrogen 48190011), dNTPs (Invitrogen 18427013 ...
-
bioRxiv - Plant Biology 2024Quote: ... Gene-specific primers contained flanking Gateway (Invitrogen) recombination sequences (Supplementary Table S1) ...
-
bioRxiv - Cell Biology 2024Quote: ... oligo (dT) 12-18 Primer (Invitrogen 18418012) and RNaseOUT Recombinant Ribonuclease Inhibitor (Invitrogen 10777019) ...
-
bioRxiv - Biochemistry 2024Quote: ... 100 pmol Random Hexamer Primers (Thermo Scientific), 0.5 mM dNTPs (NEB) ...
-
bioRxiv - Neuroscience 2024Quote: ... Taqman primers used were (Thermo Fisher Scientific): U6 snRNA (Assay ID ...
-
Candida albicans enhance Staphylococcus aureus virulence by progressive generation of new phenotypesbioRxiv - Microbiology 2024Quote: ... with Random Hexamer primers (Thermo Fisher Scientific) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: ... D147N mutation was introduced within the CSN5 overexpression construct (pEhHYG-tetR-O-CSN5 sense clone) by inverse PCR with 5’ phosphorylated primers and Platinum™ SuperFi™ DNA Polymerase (Thermo Fisher Scientific # 12351010) followed by Dpn1 digestion and self-ligation ...
-
bioRxiv - Microbiology 2022Quote: ... AMPure XP beads at a ratio of 0.8:1 to remove primer dimers and a final cleanup using the Purelink PCR Purification Kit (Life Technologies Cat #K310001; Grand Island, NY). The purified pool was quantified in triplicate with a Qubit fluorimeter prior to sequencing.
-
bioRxiv - Cancer Biology 2020Quote: Sanger sequencing on CEBPA or JAK2 were performed using gene-specific PCR primers for target amplification and incorporation of BigDye Terminator (Applied biosystems, Foster City, CA, USA). T7 promoter and terminator sequences fused to gene specific primers were used for sequencing on an ABI 3730 fragment analyzer (Applied biosystems ...
-
bioRxiv - Animal Behavior and Cognition 2020Quote: ... we used fluorescently labeled primers to amplify genomic DNA by PCR and scanned the products using an ABI 3100 capillary sequencer (Applied Biosystems, Foster City, CA, USA). For the SNPs ...
-
bioRxiv - Cell Biology 2022Quote: ... coding sequences of CMV MPs and CmVPS41s were PCR amplified using specific primers (Supplemental table 1) and cloned into plasmid pENTR/D-TOPO (Thermo Scientific by Thermo Fisher Scientific, Vilnius, Lithuania). Both MP genes were cloned into the pGBKT7 vector at the BamHI and EcoRI sites using T4 DNA ligase (Thermo Scientific by Thermo Fisher Scientific ...
-
bioRxiv - Plant Biology 2022Quote: ... MLO2 and MLO6 cDNA and MLO12 genomic sequences were amplified by PCR using suitable primers and integrated via BP recombination into Gateway®-compatible pDONR221 entry vectors (Thermo Fisher Scientific, Darmstadt, Germany). Inserts and the EXO70H4 were co-shuttled via multi- site Gateway® recombination into plant expression vectors pK7m34GW ((Karimi et al. ...
-
bioRxiv - Microbiology 2024Quote: ... DNA Fragments were subsequently cloned into a PCR-linearized pZE21 expression vector (primers 1 and 2) through blunt-ended ligation (Thermo Fisher Rapid DNA Ligation kit). Ligated products were run on a 0.5% agarose gel to isolate fragments between 5 and 10 kb ...
-
bioRxiv - Evolutionary Biology 2023Quote: Viral load was quantified in each aliquot by RT-qPCR using standard curves and specific forward F117 and reverse F118 primers in an ABI StepOne Plus Real-time PCR System (Applied Biosystems, Foster City CA, USA) as described elsewhere (Cervera et al ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... PCR of a small piece of culture tissue was performed using primers ITS1 and ITS471 with Phire Plant Direct PCR Kit (Thermo Fisher Scientific, Waltham, MA, USA) following the manufacturer’s recommendations ...
-
bioRxiv - Zoology 2024Quote: ... with optimized primers designed using Geneious Pro Bioinformatics Software (Supplement Table S1) on a StepOnePlus Real-Time PCR System (Applied Biosystems, Carlsbad, CA, United States) using PowerUPTM SYBR® Green Master Mix (Applied Biosystems ...
-
bioRxiv - Neuroscience 2023Quote: ... Aliquots of the master mix containing all of the reaction components with the primers were dispensed into a real-time PCR plate (Applied Biosystems, Foster City, CA, USA). All PCR reagents were from a SYBR Green core reagent kit (Applied Biosystems) ...
-
bioRxiv - Microbiology 2023Quote: ... PCR fragments were amplified using appropriate primer pairs (Table S1) and Phusion High-Fidelity PCR Master Mix with GC Buffer (Thermo Scientific, Walthman, MA, United States). Linear fragments were purified on agarose gels and inserted into pGMCS backbone linearized by PCR amplification with appropriate primers ...
-
bioRxiv - Biochemistry 2023Quote: ... cyriacigeorgica clinical isolate responsible for pulmonary nocardiosis was used as a template for polymerase chain reaction (PCR) with primers 5’- gatatgcaccacggcctgca-3’ and 5’-acggcgacgaagaagcgga-3’ by using Invitrogen™ Platinum SuperFi II DNA Polymerase (Thermo Fisher Scientific, Illkirch, France). A second PCR was performed on the aforementioned amplicon to amplify the truncated version of NCY-1 with the following forward 5’-ggtaccgagaacctgtacttccagggttcggccgtggccgatccccggttcgccgcactggaaacg-3’and reverse 5’- gtggtgctcgagctaaccgagcacgtcgacgaccgtcctggtcgcgtcggc-3’primers ...
-
bioRxiv - Microbiology 2024Quote: ... VN and Strand-Switching primers from the cDNA-PCR Sequencing Kit (ONT #SQK-PCS109) were used with Maxima H Minus Reverse Transcriptase (Thermo Fisher Scientific, Waltham, MA, USA) for reverse transcription and strand switching with the following parameters ...
-
bioRxiv - Immunology 2021Quote: Compensation was set in each experiment using UltraComp eBeads™ (Invitrogen) and dead cells and doublets were excluded from analysis ...
-
bioRxiv - Cell Biology 2022Quote: ... the sample tubes were set on DynaMag-2 (Thermo Fisher Scientific), and Dynabeads were washed three times with IP buffer ...
-
bioRxiv - Biochemistry 2020Quote: ... were set up in a 384-well plate (Thermo Scientific 164610) on ice ...
-
bioRxiv - Cell Biology 2021Quote: Two sets of TPD52 siRNA duplexes were synthesized by Thermo Fisher Scientific ...
-
bioRxiv - Molecular Biology 2022Quote: ... Tandem Mass Tag (TMT)11plex Isobaric Label Reagent Set (ThermoFisher Scientific) was utilized for this application ...
-
bioRxiv - Biochemistry 2022Quote: ... a set of protein standards (NativeMark™ Unstained Protein Standard, Invitrogen) are used for calibration and to generate a standard curve ...
-
bioRxiv - Immunology 2022Quote: ... The FoxP3/Transcription Factor Staining Buffer Set (Invitrogen, 00-5523-00) was used for intracellular staining of mouse FoxP3 ...
-
bioRxiv - Cell Biology 2019Quote: ... after labeling with TMT reagents (TMT10plex label reagent set, Thermo Scientific), according to manufacturer’s instructions ...
-
bioRxiv - Biophysics 2020Quote: ... Data sets were acquired on Titan Krios electron microscope (ThermoFisher Scientific) equipped with an XFEG and operated at a voltage of 300 kV ...
-
bioRxiv - Molecular Biology 2020Quote: All data sets were collected on a Titan Krios (Thermo Fisher), operated at an acceleration voltage of 300kV ...
-
bioRxiv - Developmental Biology 2020Quote: ... RNA ISH probe sets were designed and produced by Thermo Fisher Scientific ...