Labshake search
Citations for Thermo Fisher :
3601 - 3650 of 10000+ citations for rno mir 134 RT PCR Primer Set since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2022Quote: ... Overview tile sets were recorded using MAPS software (Thermofisher Scientific) before being sputter coated with a thin layer of platinum ...
-
bioRxiv - Plant Biology 2022Quote: ... Data sets were processed by Compound Discoverer (Thermo Fisher Scientific), searching our in-house library and publicly available spectral libraries with a mass accuracy of 3 ppm for precursor masses and 10 ppm for fragment ion masses.
-
bioRxiv - Neuroscience 2023Quote: ... Gates were set manually with compensation beads (Life Technologies, A10497) and appropriate control samples ...
-
bioRxiv - Systems Biology 2023Quote: ... One set of ERCC RNA Spike-In Control Mixes (Ambion) was added ...
-
bioRxiv - Cell Biology 2023Quote: ... the coverslip was set in an AttofluorTM cell chamber (Invitrogen) and observed by TIRF Microscope.
-
bioRxiv - Developmental Biology 2023Quote: Two sets of Protein G Dynabeads (Thermo Fisher Scientific, 10004D) were washed twice with 1ml ChIP dilution buffer (16.7 mM Tris-HCl pH 8.1 ...
-
bioRxiv - Cancer Biology 2023Quote: ... after which Matrigel would be set and organoid media (Gibco Advanced DMEM/F12 ...
-
bioRxiv - Immunology 2024Quote: ... and mounted with SlowFade Glass Soft-set Antifade Mountant (ThermoFisher). Images were collected using a Zeiss LSM800 confocal microscope (Confocal Microscopy Core ...
-
bioRxiv - Microbiology 2024Quote: ... Overview tile sets were recorded using MAPS software (Thermofisher Scientific) before being sputter coated with a thin layer of platinum ...
-
bioRxiv - Molecular Biology 2024Quote: ... An initial set of 60 constructs was ordered from Invitrogen GeneArt Gene Synthesis Services (ThermoFisher Scientific ...
-
bioRxiv - Microbiology 2024Quote: ... A reaction was set up with an AmpliTaq kit (Invitrogen) using 1× PCR buffer II ...
-
bioRxiv - Neuroscience 2024Quote: ... or Hprt probe set (ThermoFisher Scientific; #SA-50339, #SA-10003) was added to appropriate wells for a final volume of 100 μl ...
-
bioRxiv - Microbiology 2021Quote: ... A master mix with reverse transcriptase (RT) buffer and 20 U Maxima RT (Thermo Fisher Scientific) was added and the reaction was allowed to proceed for 1 h at 50°C ...
-
bioRxiv - Physiology 2020Quote: Two μg of total RNA was used for reverse transcription (RT) with RT kit (Applied Biosystems) using specific primer sets supplied by Taqman kit for miRNA-7-1-5p ...
-
bioRxiv - Microbiology 2020Quote: ... We included two RT-qPCR kits QuantiNova and AgPath-ID One-Step RT-qPCR (ThermoFisher Scientific), two different platforms (CFX96 and LC480 I ...
-
bioRxiv - Microbiology 2023Quote: ... 5X No-RT Master Mix for no-RT reactions (Thermo Fisher Scientific – South San Francisco, CA), and ∼0.9 ng of RNA for each reaction ...
-
bioRxiv - Cancer Biology 2021Quote: ... Chromatin-immunoprecipitated DNA was analyzed by quantitative PCR with binding site-specific primers (Extended Data Table 2) using PowerUP SYBR green master mix (Thermo Fisher Scientific, Cat # A25743) and a 7900HT Fast Real-Time PCR machine (Applied Biosystems) ...
-
bioRxiv - Plant Biology 2019Quote: ... and 5 μl was used in a 20 μl PCR reaction with 1 μl of each 10 μM primer and 10 μl of VeriQuest SyBr with Fluorescein kit (Affymetrix, Santa Clara, CA, USA). For each reaction ...
-
bioRxiv - Genetics 2019Quote: ... The Tmem98 open reading frame without the initiating ATG was amplified by PCR using primers 5’-CACCGAGACTGTGGTGATCGTCG-3’ and 5’-AATGGCCGACTGTTCCTGCAG-3’ and cloned into pENTR™/D-TOPO™ (Thermo Fisher Scientific) and subsequently into pcDNA™6.2/N-EmGFP-DEST (Thermo Fisher Scientific ...
-
bioRxiv - Genetics 2019Quote: ... The Tmem98 open reading frame with the initiating ATG was amplified by PCR using the primers 5’-CACCATGGAGACTGTGGTGATCGTCG-3’ and 5’-AATGGCCGACTGTTCCTGCAG-3’ and cloned into pENTR™/D-TOPO™ (Thermo Fisher Scientific) and subsequently into pcDNA™-DEST40 (Thermo Fisher Scientific ...
-
bioRxiv - Cancer Biology 2019Quote: ... and Tns4 cDNAs were polymerase chain reaction (PCR)-amplified using the primers listed in Supplementary Table 1 and sub-cloned in pcDNA3.1+ (Thermo Fisher Scientific, Waltham, MA, USA) and pSBtet-GFP-Neomycin (pSBtet-GN ...
-
bioRxiv - Physiology 2021Quote: ... The reaction was carried out for selected genes using intron-spanning primers (Table 1) and the StepOnePlus Real-Time PCR system (Life Technologies, Thermo Fischer, USA). Samples were subjected to the following cycle ...
-
bioRxiv - Biochemistry 2020Quote: ... coli PepP coding sequence was PCR-amplified (primers 1 and 2) from BW25113 genomic DNA prepared using a GeneJET Genomic DNA Purification Kit (Thermo Scientific, Cat No. K0721) according to the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2020Quote: ... A final concentration of 0.2 μM of each primer was used in a StepOne Real-Time PCR system (Applied Biosystems, Foster City, California, USA). Quantitative PCR (qPCR ...
-
bioRxiv - Neuroscience 2020Quote: 20ng of DNA was amplified for PSEN1-Exon6 using forward (5’ GGTTGTGGGACCTGTTAATT 3’) and reverse (5’ CAACAAAGTACATGGCTTTAAATGA 3’) primers with AmpliTaq Gold® 360 PCR Master Mix (Thermofisher, Waltham, MA, USA). Sanger sequencing was performed using BigDye™ Terminator v3.1 Cycle Sequencing Kit (Thermofisher ...
-
bioRxiv - Biochemistry 2022Quote: ... technique127 with amplicons obtained from PCR using the primers found in Table S2 (Integrated DNA Technologies, Coralville, IA) and the Herculase II DNA polymerase (Life Technologies, Grand Island, NY). For the marker-exchange plasmids ...
-
bioRxiv - Developmental Biology 2021Quote: ... Relative gene expression of SELENOT and NeuN was quantified by real-time PCR (qPCR) with specific primers and the Fast SYBR® Green Master Mix (Applied Biosystems, Courtaboeuf, France). qPCR was carried out on QuantStudio™ Flex’ system (Applied Biosystems) ...
-
bioRxiv - Plant Biology 2019Quote: ... was amplified from Tak-1 genomic DNA by PCR with the primers GCAM1pro_L1 and GCAM1pro_R2 and cloned into the pENTR™/D-TOPO® cloning vector (Life Technologies, Rockville, MD, USA). This entry vector was used in the Gateway® LR reaction (Life Technologies ...
-
bioRxiv - Genetics 2020Quote: ... were cleaned-up using shrimp alkaline phosphatase and directly sequenced in both directions using the Applied Biosystems 3730xl DNA Analyzer with the same primers used in PCR (Applied Biosystems, Waltham, Massachusetts, USA). Direct sequencing followed by BigDye Terminator or BigDye Primer methodologies per manufacturer recommendations (Sequetech ...
-
bioRxiv - Zoology 2020Quote: ... QPCRs were performed using ChamQ Universal SYBR qPCR Master Mix (Vazyme Biotech) green and gene-specific primers with a QuantStudio 5 System PCR System (Applied Biosystems, Austin, TX, USA). QPCR cycling parameters were 95°C for 30 s ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... Cycle sequencing reactions were performed directly using the two PCR primers using the BigDye Terminator version 3.1 Cycle Sequencing Kit (Applied Biosystems, Foster City, CA, USA) and analyzed on an ABI Prism 3130 x genetic analyzer (Applied Biosystems ...
-
bioRxiv - Molecular Biology 2023Quote: ... Genomic PCR of 20 cycles was then performed with the respective primer pair on the extracted DNA utilising the Phusion Flash High-Fidelity PCR Master Mix (Thermo Fisher Scientific, F-548L) as described by the manufacturer ...
-
bioRxiv - Molecular Biology 2023Quote: ... The rfc3 gene was amplified from Xenopus egg cDNA by two-step PCR using primers listed in Supporting Table S1 and cloned into pDONR201 (Thermo Fisher Scientific, MA, USA) by the Gateway BP reaction ...
-
bioRxiv - Bioengineering 2023Quote: ... until 4 h then real-time PCR was performed using cDNA from each replicate and gene-specific primers with a powerup™ sybr® green master mix (ThermoFisher Scientific, USA) in the Quantstudio 5 (ThermoFisher Scientific ...
-
bioRxiv - Molecular Biology 2021Quote: ... Using Superscript III RT (ThermoFisher Scientific), reverse transcription was performed at 50°C for 120 min in a 25 μl volume with 100 ng RNA and the reverse primer YrDNA18R (Table 1) ...
-
bioRxiv - Molecular Biology 2021Quote: ... 200 U SuperScript III RT (Invitrogen), and 40 U RNase Inhibitor in a 20 μL reaction volume.
-
Redundant and specific roles of cohesin STAG subunits in chromatin looping and transcription controlbioRxiv - Cell Biology 2019Quote: ... Superscript IV Reverse Transcriptase (RT) (Invitrogen) and RNaseOUT Recombinant Ribonuclease Inhibitor (Invitrogen ...
-
bioRxiv - Biochemistry 2019Quote: ... 1x Maxima RT Buffer (Thermo Scientific), and 200 U Maxima Reverse Transcriptase (Thermo Scientific) ...
-
bioRxiv - Microbiology 2021Quote: ... 1μL SuperScript III RT (Invitrogen, USA) and 4μL SSIII First Strand Buffer (Invitrogen ...
-
bioRxiv - Microbiology 2021Quote: ... 1μL SuperScript III RT (Invitrogen, USA) and 4μL SSIII First Strand Buffer (Invitrogen ...
-
bioRxiv - Microbiology 2020Quote: ... SuperScript III RT (Thermo Fisher Scientific) was used with a combination of oligo(dT) ...
-
bioRxiv - Neuroscience 2020Quote: ... 9.3 U SuperScript II RT (Invitrogen), 1.85 U recombinant RNase Inhibitor (Takara) ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... Superscript II RT (180064022, Invitrogen™) and BCA protein assay KIT (23225 ...
-
bioRxiv - Physiology 2021Quote: ... and 5x RT buffer(Thermo Scientific). cDNA was then diluted to 12.5ng/µl using molecular grade water ...
-
bioRxiv - Microbiology 2020Quote: ... 62 U Superscript III RT (Invitrogen), 0.62 μl dNTPs 25 mM each (Omega Bio-Tek ...
-
bioRxiv - Genetics 2022Quote: ... and 0.7μl Maxima RT (Thermo Scientific) was incubated at 50°C for two hours then 85°C for 5 min ...
-
bioRxiv - Systems Biology 2019Quote: ... and RT using SuperScript III (ThermoFisher) was performed according to the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2020Quote: ... and 1 U MultiScribe RT (Invitrogen) in RT Buffer (25 mM KCl ...
-
bioRxiv - Synthetic Biology 2021Quote: ... 9.3 U SuperScript II RT (Invitrogen), 1.85 U recombinant RNase Inhibitor (Takara) ...
-
bioRxiv - Molecular Biology 2019Quote: ... (vii) MM_DM1_H-(SuperScript III RT, Invitrogen) consisted of 10 DM1-model and 10 control samples of the HSALR transgenic mouse model of DM1 and control background FVB mice ...