Labshake search
Citations for Thermo Fisher :
3651 - 3700 of 10000+ citations for rno mir 134 RT PCR Primer Set since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2019Quote: ... (iii) BP1_DM1_H-(SuperScript III RT, Invitrogen) consisted of 8 DM1 and 2 control samples ...
-
bioRxiv - Molecular Biology 2021Quote: Maxima H Minus RT (Thermo Scientific) was used according to manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2021Quote: ... 200 U SuperScript III RT (Invitrogen). Typically ...
-
bioRxiv - Immunology 2021Quote: ... The PrimeScript RT reagent kit (Invitrogen) was employed to synthesize cDNA ...
-
bioRxiv - Physiology 2022Quote: ... Superscript RT II was from Invitrogen, Carlsbad ...
-
bioRxiv - Genomics 2022Quote: ... 1μl 10x RT buffer (ThermoFisher Scientific), 1μl 0.1M DTT ...
-
bioRxiv - Microbiology 2023Quote: ... and SuperScript III RT (Invitrogen/ThermoFisher) per manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: ... and SuperScript III RT (Invitrogen/ThermoFisher) per manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2023Quote: ... 5x RT Buffer (Thermo Fisher Scientific), ONT Strand-Switching Primer were added to the mixtures and they were incubated at 42°C for 2 min ...
-
bioRxiv - Neuroscience 2023Quote: ... Maxima RT enzyme (Thermo Scientific, EP0743), and RiboLock RNAse inhibitor (Thermo Scientific ...
-
bioRxiv - Microbiology 2023Quote: ... 5x RT Buffer (Thermo Fisher Scientific), and ONT Strand-Switching Primer were added to the mixtures ...
-
bioRxiv - Cancer Biology 2023Quote: ... at RT (Thermo Fisher, Cat#A1049201). Next ...
-
bioRxiv - Neuroscience 2023Quote: ... (1:300; 4 h, RT, Invitrogen) were used as secondary antibodies ...
-
bioRxiv - Biochemistry 2024Quote: ... 1x Maxima RT Buffer (Thermo Scientific), and 200 U Maxima Reverse Transcriptase (Thermo Scientific) ...
-
bioRxiv - Cell Biology 2020Quote: ... cells were transfected with miR-874 or a scramble miRNA mimics molecule for 48 h with RNAimax(Life Technologies) in OPTI-MEM reduced serum medium following the manufacturer’s recommendations.
-
bioRxiv - Cancer Biology 2019Quote: ... LNCaP-MR42D or LNCaP cells were seeded at 4×103 cells/well in 96-well plates and transfected in suspension with 12.5 or 6.25nM miR LNA inhibitor using RNAiMAX (Life Technologies). Cell viability was assesses using the Cell Titer-Glo Luminescent Cell Viability Assay (Promega ...
-
bioRxiv - Cancer Biology 2019Quote: ... in 12-well plates and transfected in suspension with 12.5 or 6.25 nM miR LNA inhibitor using RNAiMAX (Life Technologies). Live and dead cells were quantified at indicated time points using Trypan blue.
-
bioRxiv - Physiology 2019Quote: ... and a non-targeting pre-miRNA under bicistronic control of the CMV promoter in the pcDNA6.2GW/EmGFP-miR plasmid (Invitrogen). The UBR5 RNAi plasmid encodes EmGFP and an artificial pre-miRNA targeting mouse UBR5 under bicistronic control of the CMV promoter ...
-
bioRxiv - Physiology 2020Quote: ... and a non-targeting pre-miRNA under bicistronic control of the CMV promoter in the pcDNA6.2GW/EmGFP-miR plasmid (Invitrogen). The UBR5 RNAi plasmid also encodes EmGFP plus an artificial pre-miRNA targeting mouse UBR5 under bicistronic control of the CMV promoter ...
-
miR-206 inhibits estrogen-induced proliferation and invasion of ER-α36 positive gastric cancer cellsbioRxiv - Cancer Biology 2021Quote: ... Transfection of the cells with miR-206 mimic was accomplished by mixing the transfection reagent Lipofectamine 2000 (Invitrogen, USA) with 100 pmol siRNA oligomer in a reduced serum medium.
-
bioRxiv - Molecular Biology 2019Quote: ... an equal concentration of a non-targeting sequence mirVana™ miRNA mimic Negative Control #1 (miR-NC) (4464058, Ambion) was used.
-
bioRxiv - Developmental Biology 2021Quote: ... the miR-202 or scrambled NC mimics of 100 nM were first transfected using the Lipofectamine RNAiMAX Reagent (Invitrogen). Ten hours later ...
-
bioRxiv - Developmental Biology 2021Quote: ... the miR-202 or scrambled NC mimics of 100 nM were first transfected using the Lipofectamine RNAiMAX Reagent (Invitrogen). Ten hours later ...
-
bioRxiv - Cancer Biology 2020Quote: ... For overexpression of miR-7704 the MDA-MB-231 cells were grown in six-well plates and transfected for 48h with pPRIME-miR-7704-CMV-GFP-FF3 plasmid (5.5 µg/well) using Lipofectamine-2000 reagent (ThermoFisher). As control ...
-
bioRxiv - Cancer Biology 2022Quote: ... were treated with weekly intratumor injections of 0.5 nmol miRNA mimics (miR-28 or control) together with invivofectamine (Ambion).
-
bioRxiv - Microbiology 2022Quote: ... cells were forward transfected with miR-TAR-3p (mirVana™ miRNA Mimic, mature sequence: UCUCUGGCUAACUAGGGAACCCA, Ambion Cat. No# 4464066) or NC1 (miRNA precursor negative controls #1 ...
-
bioRxiv - Cell Biology 2024Quote: ... miR-218-5p and the internal control snRNA U6 was carried out with TaqMan miRNA kits (Thermo Fisher Scientific). All qPCR assays were performed on Rotor-Gene Q thermocycler (Qiagen ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... negative control sequences (see Table below) were designed from pcDNA6.2-GW/EmGFP-miR-neg Control (Invitrogen, Carlsbad, CA, USA). For construction of pAAV-CMV-EmGFP-miRNA-S100a10 or Htr1b ...
-
bioRxiv - Neuroscience 2023Quote: Silencing of Fmr1 and Map1b has been performed using BLOCK-iT Pol II miR RNAi Expression Vector Kits (Invitrogen) and the RNAi Designer (Invitrogen) ...
-
bioRxiv - Genomics 2023Quote: TaqMan assay was performed to determine miR-124-3p levels using TaqMan™ MicroRNA Reverse Transcription Kit (ThermoFisher, 4366596), TaqMan™ MicroRNA Assay hsa-miR-124-3p (ThermoFisher ...
-
bioRxiv - Cancer Biology 2023Quote: ... according to the manufactureŕs instructions with either 10 µM pre-miR-122 miRNA Precursor (mirVana miRNA mimic, Thermo Fisher Scientific ...
-
bioRxiv - Molecular Biology 2023Quote: ... with the human dystrophin 3′ UTR or mutant 3′ UTR and with 50 nM miR-146a mimic (Life Technologies) with Lipofectamine 2000 according to the manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2023Quote: ... each vector was co-transfected with miR-421 mimics (200pM/106 cells, Cat. No. 4464066, ThermoFisher Scientific, Waltham, MA). Twenty-four hours later ...
-
bioRxiv - Neuroscience 2024Quote: ... were chosen for miR engineering into pcDNA™6.2-GW/EmGFP following the vendor’s instructions (BLOCK-iT Pol II miR RNAi Expression Vector Kits, Invitrogen). RNA interference efficacy was tested by immunoblotting HEK293 cell lysates which were co-transfected with miR constructs and a plasmid encoding full-length mVenus-tagged ADGRL1 ...
-
bioRxiv - Molecular Biology 2019Quote: ... primers and probes (F: ZIKV 1086, R: ZIKV 1162c, ZIKV 1107-FAM; TaqMan MGB Probe; Invitrogen Custom Primers) (Lanciotti et al. ...
-
bioRxiv - Cancer Biology 2020Quote: Primers and TaqMan® probes were designed using Primer Express® software version 2.0 (Applied Biosystems, Darmstadt, Germany) or Primer3 software (Steve Rozen ...
-
bioRxiv - Cancer Biology 2021Quote: ... 1µL of DNA at a concentration of 1ng/µL was mixed with either 2µL of primer Tel or primer SCR and 10µL PowerTrack SYBR Green Master Mix (ThermoFisher) with the volume of the reaction being brought up to 20µL with ddH2O ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... and 2 pmol of each primer (5’ primers labeled with Applied Biosystems fluorescent dyes FAM, HEX or NED). Thermal cycling (under mineral oil ...
-
bioRxiv - Microbiology 2020Quote: ... Primers and minor groove binder (MGB) Taqman probes (Table S2) were designed using Primer Express 3.0 (Applied Biosystems). For duplexing ...
-
bioRxiv - Neuroscience 2023Quote: ... and Odc (NM_012615.3) reference sequences were applied to design specific primer pairs (Primer Express 3.0 Software, Applied Biosystems): TCCGGGAGGATCCTAAGGAA (Kif4a fwd ...
-
bioRxiv - Microbiology 2024Quote: ... In-house designed primers were purchased from Integrated DNA Technologies and TaqMan primer assays were purchased from ThermoFisher. Host antiviral ISG expression was normalized to rat Chmp2a mRNA ...
-
bioRxiv - Microbiology 2020Quote: ... Amplification was performed using 48 pairs of specific DENV-1 primers on the Fluidigm Access Array (Fluidigm Corporation, CA) with SuperScript III™ One-Step RT-PCR utilizing Platinum Taq High Fidelity polymerase (Thermo Fisher Scientific, MA). NGS libraries were prepared with QIAseq FX DNA Library Kit and sequenced on a Miseq with a v3 600 cycle sequencing kit ...
-
bioRxiv - Cancer Biology 2019Quote: ... ESC clones were genotyped (genotyping primers are listed in Supplemental Table 2) and the sex was determined using RT-PCR to detect Y-linked Kdm5d (Thermo Fisher, Assay ID Mm00528628_cn), Tfrc was used as internal control (Thermo Fisher ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... The AIV genome segments were amplified using the SuperScript™ III one-step RT-PCR system with high fidelity Platinum™ Taq DNA polymerase (Thermo Fisher Scientific) and universal influenza A virus gene primers as previously described [73] ...
-
bioRxiv - Microbiology 2020Quote: ... Viral RNA was reverse-transcribed and amplified using the SuperScript III High Fidelity One-Step RT-PCR kit (Invitrogen, Life Technologies, Carlsbad, CA, USA). The reverse transcription-PCR conditions were as follows ...
-
bioRxiv - Microbiology 2020Quote: ... Viral RNA was reverse-transcribed and amplified using the SuperScript III High Fidelity One-Step RT-PCR kit (Invitrogen, Life Technologies, Carlsbad, CA, USA). The reverse transcription-PCR conditions were as follows ...
-
bioRxiv - Cell Biology 2021Quote: ... The cDNA was synthesized by RT-PCR from 1 μg of purified RNA with the M-MLV reverse transcriptase (Thermo Fisher Cat#: 28025-013) and random primers (Thermo Fisher Cat# ...
-
bioRxiv - Physiology 2020Quote: Quantitative RT-PCR The relative abundance of target gene mRNA in the total RNA extracts was estimated by quantitative reverse transcription (RT) real-time PCR (StepOnePlus, Applied Biosystems, Carlsbad, CA, USA). Real-time PCR reactions were performed using the Power SYBR Green PCR Master Mix Kit (Applied Biosystems ...
-
bioRxiv - Molecular Biology 2020Quote: ... Reactions were performed in technical duplicates in a 384-well format using a QuantStudio 12 K Flex RT-PCR machine (Thermo Fisher Scientific, MA, USA). Data was analyzed using the comparative Ct method (ΔΔCt ...
-
bioRxiv - Microbiology 2021Quote: ... Fluorescence was continuously monitored at an excitation/emission wavelength of 300/470-570 nm using a StepOne Plus RT-PCR thermal cycler (Applied Biosystems, Foster City, CA) as the samples were heated from 25°C to 95°C at a ramp rate of 1°C/min ...