Labshake search
Citations for Thermo Fisher :
4001 - 4050 of 10000+ citations for rno mir 134 RT PCR Primer Set since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2020Quote: ... and random hexameters primers (Cat# 48190011, ThermoFisher Scientific). Newly synthesized cDNA was diluted 1:20 (vol:vol ...
-
bioRxiv - Microbiology 2021Quote: ... specific Taqman probes and primers (Thermo Fisher 4331182) were used with TaqMan Universal PCR Master Mix (Applied Biosystems 4305719 ...
-
bioRxiv - Molecular Biology 2020Quote: ... random hexamer primers (cat # SO142, Thermo fisher scientific).
-
bioRxiv - Neuroscience 2021Quote: ... Primer Express Software (Applied Biosystems, Foster City, CA) was used ...
-
bioRxiv - Microbiology 2021Quote: ... with pre-developed primer/probe assays from ThermoFisher (CXCL8 Hs00174103_m1 ...
-
bioRxiv - Neuroscience 2022Quote: ... The GUSB probe/primer (#Hs009627_m1, Thermo Fisher Scientific) was used as a normalizer for gene expression analysis.
-
bioRxiv - Cell Biology 2022Quote: ... ACTB or 18S primers (Life Technologies, Carlsbad, CA) were used for qPCR in a QuantStudio 6 Flex Real-Time PCR System (Applied Biosystems ...
-
bioRxiv - Cell Biology 2019Quote: ... All primers were from Invitrogen (Buenos Aires, Argentina). The specific primers pairs used were ...
-
bioRxiv - Cancer Biology 2020Quote: ... and Oligo(dT)18 Primers (Thermo Scientific, SO131). Quantitative PCR was performed using a TaqMan™ Gene Expression Master Mix (4369016 ...
-
bioRxiv - Physiology 2020Quote: ... The sequences for the primers (Invitrogen, The Netherlands) used for the specific RNA and mRNA targets are shown in Table 8.
-
bioRxiv - Physiology 2020Quote: ... 0.2 mM primers (synthesized by Invitrogen, Glasgow, UK) shown in Table 1 ...
-
bioRxiv - Biochemistry 2020Quote: ... and Oligo (dT)™ primers (Invitrogen, Carlsbad, California). Primers for the Edil3 ...
-
bioRxiv - Physiology 2021Quote: ... Primers were manufactured by Invitrogen (Invitrogen Life Technologies).
-
bioRxiv - Genetics 2019Quote: ... The cDNA was synthesized using random primers (Invitrogen) and SuperScript II reverse transcriptase (Invitrogen) ...
-
bioRxiv - Neuroscience 2021Quote: ... 400 ng Anchored Oligo (dT)20 Primer (Invitrogen), 100 U Superscript III Reverse Transcriptase (Life Tech ...
-
bioRxiv - Immunology 2019Quote: ... the following Taqman primers were used (all ThermoFisher): NOD2 (Hs01550753_m1) ...
-
bioRxiv - Developmental Biology 2019Quote: ... cDNA was synthesized with oligo-dT primer (Invitrogen) and 0.5 μg (legs ...
-
bioRxiv - Genetics 2020Quote: ... followed by reverse transcription with random primers (Invitrogen). For RNA immunoprecipitation in liver tissue ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... Forward primers were labelled with fluorescent dyes (Invitrogen), and amplified PCR products were run on an ABI Prism 3730 DNA Analyzer (GS500 ROX size standard) ...
-
bioRxiv - Cell Biology 2020Quote: ... with Oligo(dT)20 Primer (ThermoFisher, 18418-020) and dNTP Mix (ThermoFisher ...
-
bioRxiv - Neuroscience 2020Quote: ... and primed with oligo-dT primers (Thermo Scientific) and random primers (Thermo Scientific) ...
-
bioRxiv - Immunology 2021Quote: ... Primers and probes were purchased from Life Technologies. Target gene expression was normalized to Hprt (hypoxanthine-guanine phosphoribosyltransferase ...
-
bioRxiv - Neuroscience 2020Quote: ... and TaqMan primers for β-Actin (ThermoFisher, Mm00607939_s1), Il-6 (ThermoFisher ...
-
bioRxiv - Developmental Biology 2020Quote: ... cDNA was synthesised using random hexamer primers (Invitrogen) and SuperScript II Reverse Transcriptase kit (Invitrogen) ...
-
bioRxiv - Genomics 2020Quote: ... B2M primer and probe were made by ThermoFisher Scientific (Cat # ...
-
bioRxiv - Microbiology 2020Quote: ... we used forward primer “TCCTACGGGAGGCAGCAGT” (Invitrogen, Carlsbad, CA) and reverse primer “GGACTACCAGGGTATCTAATCCTGTT” (Invitrogen ...
-
bioRxiv - Microbiology 2020Quote: ... Primers for LAMP reaction were synthesized by Invitrogen biotech (Shanghai ...
-
bioRxiv - Immunology 2021Quote: ... 0.5x GAPDH-VIC TaqMan primers ((Hs02758991_g1, ThermoFisher Scientific), and 5 µl cDNA ...
-
bioRxiv - Immunology 2021Quote: ... 0.5x CISH-FAM TaqMan primers (Hs00367082_g1, ThermoFisher Scientific), 0.5x GAPDH-VIC TaqMan primers ((Hs02758991_g1 ...
-
bioRxiv - Immunology 2020Quote: ... Assay on demand primers were from Applied Biosystems (Nieuwerkerk aan de IJssel ...
-
bioRxiv - Genomics 2021Quote: ... Reverse UpTag primer 5’ – CACGACGCTCTTCCGATCTAGTANNNNGGGGACGAGGCAAGCTAAGATATC-3’ (Invitrogen, UK) and reverse DnTag 5’ – CACGACGCTCTTCCGATCTAGTANNNNCGCCATCCAGTGTCGAAAAGTATC-3’ (Invitrogen ...
-
bioRxiv - Cancer Biology 2022Quote: ... Oligo dT primers (Thermo Scientific, catalog no.: 18418020) were used to ensure that mRNA with polyA tails are captured ...
-
bioRxiv - Cancer Biology 2022Quote: ... All primer-probes were purchased from Life Technologies Limited (ThermoFisher Scientific) ...
-
bioRxiv - Bioengineering 2022Quote: ... Primers were purchased from Invitrogen (Thermo Fischer Scientific). The plasmids were designed for markerless gene deletion according to Olson & Lynd (49 ...
-
bioRxiv - Immunology 2022Quote: ... All used primers were acquired from Thermo Fisher and are listed in Supplementary Table S2.
-
bioRxiv - Microbiology 2022Quote: All primers were purchased from Thermo Scientific (Finland).
-
bioRxiv - Neuroscience 2022Quote: Taqman primers used were (all from Thermo Fisher): U6 snRNA (Assay ID ...
-
bioRxiv - Molecular Biology 2022Quote: ... purified total RNA and Random Hexamer Primer (Invitrogen). cDNA was then diluted 20-fold and 1 μL were used for each qPCR reaction along with 20 nM of gene-specific oligonucleotides in a 10 μL reaction mix ...
-
bioRxiv - Physiology 2022Quote: ... and gene-specific Taqman primers (Thermo Fisher Scientific) using a CFX384 real-time PCR machine (Bio-Rad) ...
-
bioRxiv - Cancer Biology 2022Quote: ... Taqman reverse transcription primers and qPCR probes (ThermoFisher) used were as follows ...
-
bioRxiv - Molecular Biology 2024Quote: ... rat-specific primers were purchased (Thermo Fisher Scientific), including primers for 18S and GAPDH ...
-
bioRxiv - Molecular Biology 2024Quote: ... and 25 pmol of oligo‐dT primer (Invitrogen) in 8.5 μL of 1x reverse transcription buffer (Invitrogen) ...
-
bioRxiv - Genetics 2024Quote: ... Primers were from Life Technologies (Grand Island, NY). Capillary electrophoresis of fluorescently labeled PCR products and Sanger sequencing of plasmid constructs was carried out by Psomagen (Rockville ...
-
bioRxiv - Microbiology 2024Quote: ... with Oligo (dT)18 primers (Thermo Fisher Scientific) by following the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2023Quote: ... Primers included: CSPG4 (Hs00361541_g1, Thermofisher Scientific, cat.# 4331182), OCT4 (Hs01895061_u1 ...
-
bioRxiv - Physiology 2023Quote: ... and random hexamer primers (#SO142, Thermo Fisher Scientific). cDNA synthesis was performed according to the protocol ...
-
bioRxiv - Neuroscience 2023Quote: ... Primers for GAPDH (Assay ID: Mm99999915_g1, Applied Biosystems) were used to normalize the expression data ...
-
bioRxiv - Systems Biology 2023Quote: ... cDNA synthesized with random primers (48190011, Thermo Fisher) and SuperScript III reverse transcriptase (18080-085 ...
-
bioRxiv - Molecular Biology 2023Quote: Oligonucleotides or primers were purchased from Thermo Fisher Scientific (Waltham ...
-
bioRxiv - Genetics 2023Quote: ... for which random N6 primers (Thermo Fisher Scientific) and Tetro reverse transcriptase (GCBiotech ...