Labshake search
Citations for Thermo Fisher :
3951 - 4000 of 10000+ citations for rno mir 134 RT PCR Primer Set since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2023Quote: ... 1μl of MMLV-RT enzyme (Invitrogen, USA) was added ...
-
bioRxiv - Microbiology 2024Quote: ... 200 U/μL M-MLV-RT (Invitrogen). Gene expression analysis was performed on an Applied Biosystems Quantstudio 3 Real-Time PCR System ...
-
bioRxiv - Genomics 2024Quote: ... 1x Maxima RT buffer (Thermo Fisher, EP0742), 600 units/ml RNAse inhibitor ...
-
bioRxiv - Neuroscience 2024Quote: ... 8 U/μL MLV RT (Invitrogen, 28025013) and 1 mM DTT (Invitrogen ...
-
bioRxiv - Neuroscience 2020Quote: ... Quantitative RT-PCR reaction was performed with primers (Nmnat1-forward: AGAACTCACACTGGGTGGAAG, Nmnat1-reverse: CAGGCTTTTCCAGTGCAGGTG, Gapdh-forward: TGCCCCCATGTTTGTGATG, Gapdh-reverse: TGTGGTCATGAGCCCTTCC with reaction mixture (ThermoFisher, SYBR® Green PCR Master Mix) and monitored with Prism 7900HT (ABI ...
-
bioRxiv - Genetics 2022Quote: ... The PCR fragments of primer pair pQT4MiF - pQT17MiR and primer pair pQT17MiF - pQT25MiR were subcloned into pCRblunt using Zero Blunt™ TOPO™ PCR Cloning Kit (ThermoFisher Scientific, catalog number 450245) following the manufacture’s protocol ...
-
bioRxiv - Developmental Biology 2024Quote: ... and qRT-PCR was performed with primers listed in the Supplementary Table 1 and TaqMan 2X master mix (Applied Biosystems/Life Technologies, Grand Island, NY, USA) on a 7500 Fast Real-time PCR system (Applied Biosystems/Life Technologies) ...
-
bioRxiv - Molecular Biology 2021Quote: RT-qPCR was carried out on cDNA prepared with mix of Random Primers and oligo-d(T) primer and SuperScript III Reverse Transcriptase (ThermoFisher) from 2 µg of RNA following DNase I digestion (Turbo DNase ...
-
bioRxiv - Molecular Biology 2019Quote: Three specific 5’ RACE primers and two 3’ RACE primers were designed according to the Race kit instructions (Invitrogen & Clontech) (Table S1) ...
-
bioRxiv - Cancer Biology 2019Quote: ... ssDNA (M13 primer ssDNA-M13 primer 5’-TGT-AAA-ACG-ACG-GCC-AGT-3’, paraformaldehyde (PFA) were purchased from ThermoFisher. PicoGreen variants were synthesized in house at ThermoFisher ...
-
bioRxiv - Cell Biology 2021Quote: ... The precore precursor gene was amplified using the forward primer 5’-ATCTAAAGCTTACCATGCAACTTTTTCACCTCT-3’ and reverse primer 5’-TAGATGGATCCCTAACATTGAGGTTCCCGAG-3’ and introduced into the pCEP vector (Invitrogen) via HindIII and BamHI restriction sites ...
-
bioRxiv - Microbiology 2019Quote: QSG-MSP was performed to quantify the levels of CpG DNA methylation of CD4 and RUNX3.Primers for QSG-MSP were designed using Methyl Primer Express Software v1.0 (Applied Biosystems). Primer sequences for CD4 ...
-
bioRxiv - Molecular Biology 2020Quote: ... Real-time PCRs were performed on Applied Biosystems 7500 Fast Real-Time PCR System using the respective pair of primers designed with Primer Premier 6.0 and Maxima SYBR Green/ROX qPCR Master Mix (Thermo Scientific). PCR reactions were performed in four replicates ...
-
bioRxiv - Microbiology 2020Quote: ... cDNA was synthesized using the env V1/V3 Primer ID primer (HXB2 positions 6585-7208): 5’-GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTNNNNNNNNNCAGTCCATTTTGCT CTACTAATGTTACAATGTGC-3’ and SuperScript III Reverse Transcriptase (Invitrogen). The final cDNA reaction contained the following ...
-
bioRxiv - Microbiology 2021Quote: ... and random hexamer (0.1µg) primers or HA-specific primer and a RevertAid first-strand cDNA synthesis kit (Invitrogen, Thermo Fisher Scientific) according to the manufacturer’s instructions.
-
bioRxiv - Genomics 2020Quote: ... The assay primers and TaqMan probes for the sequences were produced using Primer Express 3.0.1 (Thermo Fisher Scientific, Waltham, MA) with primer melting temperature (Tm ...
-
bioRxiv - Immunology 2019Quote: ... RT-qPCR was performed using primer sequences provided in Table S5 and either SYBR-Green (PrecisionPLUS, Primer Design, UK) or a Taqman (Invitrogen) assay (TRIB1 ...
-
bioRxiv - Genetics 2021Quote: ... PCR amplification products from microsatellite TA119 (forward primer: TCCTCGATTATATTATTGCA; reverse primer: TAATACATTCCCATTAGATC) were analyzed using Applied Biosystems 3730xI DNA Analyzer (ThermoFisher). Relative density of amplicons from each parent was then scored by the height of corresponding fluorescent peak comparing to the overall signal.
-
Reducing mitochondrial ribosomal gene expression does not alter metabolic health or lifespan in micebioRxiv - Cell Biology 2022Quote: ... Genotyping proceeded according to the ICS protocol (Forward primer Ef 4877 5’-GACCCACATAAGCAGGGAAGGAGATG-3’, reverse primer L3r 4879 5’-CAATCTCCTGAGAATGTAGCCCACCAT-3’, Invitrogen). The Mrpl54 knock-out allele generated a 402 base-pair (bp ...
-
bioRxiv - Developmental Biology 2022Quote: ... using primers with the appropriate Gateway sites (see Table S5 for primer details) and cloned into BP Gateway pDONR221 Vector (Invitrogen), then LR recombined into pDEST22 (prey ...
-
bioRxiv - Neuroscience 2024Quote: ... GFP primers were 50-ACT ACA ACA GCC ACA ACG TCT ATA TCA-30 and reverse primer 50-GGCGGATCTTGAAGTTCACC-30 (Invitrogen) and the probe was 50-6-FAM-CCG ACA AGC-ZENAGA AGA ACG GCA TCA-Iowa Black FQ-30 (Integrated DNA Technologies ...
-
bioRxiv - Synthetic Biology 2023Quote: ... First-strand cDNA synthesis was performed with a gene-specific primer that contained a unique molecular identifier (primer MP56-2, Table S7) and SuperScript IV Reverse Transcriptase (Invitrogen). qPCR was performed on mRNA samples before and after reverse transcription to verify that samples were free from any plasmid DNA ...
-
bioRxiv - Plant Biology 2024Quote: Gene-specific primer pairs and TaqMan probes for BYV and BChV were designed in collaboration with GEVES (Angers, France) using the Primer Express 3.0.1 primer design tool (Thermo Fisher Scientific). Primer sets were designed to amplify between 75 to 200 nucleotides of the BYV and BChV genomes (Table 1) ...
-
bioRxiv - Cancer Biology 2021Quote: ... and random primers (Thermo Fisher Scientific, Cat # 48190). 1 µg of total RNA was used for cDNA synthesis ...
-
bioRxiv - Neuroscience 2021Quote: ... and TaqMan primers for β-Actin (ThermoFisher, Mm00607939_s1), Arpc3 (ThermoFisher ...
-
bioRxiv - Neuroscience 2022Quote: ... and specific primers in a StepOnePlus (Applied Biosystems). PCR primer sequences (sense and antisense ...
-
bioRxiv - Neuroscience 2021Quote: ... and a random primer mix (Thermo Fisher Scientific). Quantitative PCR (qPCR ...
-
bioRxiv - Molecular Biology 2019Quote: ... random primer and M-MLV Reverse Transcriptase (Invitrogen). For the intron cDNA same condition were used ...
-
bioRxiv - Cell Biology 2022Quote: ... The mRNA TaqMan kit and primers (Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2020Quote: ... oligo(dT) primers (Thermo Fisher Scientific, Waltham, MA), and deoxynucleoside triphosphates (Promega ...
-
bioRxiv - Cell Biology 2019Quote: ... Primers and probes were acquired from Thermo Fisher Scientific ...
-
bioRxiv - Genomics 2019Quote: ... with Oligo(dT)20 primers (Thermo Fisher Scientific) according to the manufacturer’s instructions ...
-
Virus-mediated transient expression techniques enable genetic modification of Alopecurus myosuroidesbioRxiv - Genetics 2020Quote: ... and Oligo(dT)20 Primer (Invitrogen cat# 18418020) with RNaseOUT™ Recombinant Ribonuclease Inhibitor (Invitrogen cat# 10777-019).
-
bioRxiv - Evolutionary Biology 2019Quote: ... Universal primers and BigDye Terminator Chemistry (Applied Biosystems) were used for Sanger sequencing randomly selected plasmid subclones to a depth of 10x ...
-
bioRxiv - Molecular Biology 2021Quote: ... with Oligo(dT)18 primer (Thermo Fisher Scientific), and analyzed by PCR using TaKaRa Ex Taq polymerase (Takara Bio ...
-
bioRxiv - Bioengineering 2020Quote: ... using 10 ng cDNA and Taqman primers (ThermoFisher). A Taqman PCR kit (ThermoFisher ...
-
bioRxiv - Neuroscience 2021Quote: ... with the miRNA-specific commercial primers (ABI, Thermofisher, see Supplementary Table 1 for the list of primers used) ...
-
bioRxiv - Neuroscience 2021Quote: ... qPCR was performed with Taqman primers (Life Technologies) on an ABI 7500 Real-Time PCR System ...
-
bioRxiv - Cancer Biology 2020Quote: ... with Oligo(dT)12-18 Primer (Invitrogen #18418012). qRT-PCR was performed on the cDNA using a CFX Connect Real-Time PCR Detection System (Bio-Rad ...
-
bioRxiv - Biochemistry 2021Quote: ... The custom designed primers were ordered from Invitrogen. Relative gene expression was determined from cDNA using NZYTaq 2× Green Master Mix (MB03903 ...
-
bioRxiv - Physiology 2021Quote: ... The Primer Express 3.0 (Applied Biosystems, CA, USA) and OligoAnalyzer 3.1 (Integrated DNA Technology ...
-
bioRxiv - Microbiology 2020Quote: ... Primers were removed with Exonuclease I (Invitrogen™). Primers sets used for preamplification were primed into the 48×48 Biomark assay plates ...
-
bioRxiv - Physiology 2021Quote: ... Probes and primers were obtained from Applied Biosystems, Foster City ...
-
bioRxiv - Microbiology 2021Quote: ... SuperScript III reverse transcriptase and random primers (Invitrogen) were used to perform reverse transcription ...
-
bioRxiv - Microbiology 2019Quote: ... 5 pmol random hexamer primer (#SO142, Thermo Scientific), 10 units Klenow Fragment (#EP0051 ...
-
bioRxiv - Cell Biology 2021Quote: ... and random primers (Life Technologies, Frederick, MD, USA). Quantitative RT-PCR was performed using the FastStart Universal SYBR Green Master (ROX ...
-
bioRxiv - Neuroscience 2020Quote: ... 0.5uM each primer (IDT) and 1.5u DreamTaq (Thermofisher). All of the amplifications were performed on a BioRad C1000 thermal cycler ...
-
bioRxiv - Cell Biology 2020Quote: ... RNA underwent reverse-transcription with random primers (Invitrogen) and reverse transcriptase ...
-
Telomerase deficiency in humans is associated with systemic age-related changes in energy metabolismbioRxiv - Cell Biology 2022Quote: ... TS primer (0.1μg, 100ng/μL; Invitrogen TM, US), ACX primer (0.05μg ...
-
Telomerase deficiency in humans is associated with systemic age-related changes in energy metabolismbioRxiv - Cell Biology 2022Quote: ... ACX primer (0.05μg, 100ng/μL; Invitrogen TM, US), 250ng of sample protein extract and nuclease-free water (Ambion ...