Labshake search
Citations for Thermo Fisher :
3751 - 3800 of 10000+ citations for 2 3 5 6 Tetrahydroxy 4 phosphonooxycyclohexyl dihydrogen phosphate since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2021Quote: ... 6 mM MgCl2 (Ambion), 1 μM TSO-primer* (Metabion) ...
-
bioRxiv - Neuroscience 2021Quote: ... Amira Software 6 (ThermoFisher) was used for all 3D renderings ...
-
bioRxiv - Neuroscience 2020Quote: ... Il-6 (ThermoFisher, Mm00446190_m1), Tnf-α (ThermoFisher ...
-
bioRxiv - Immunology 2021Quote: ... Il-6 (Mm00446190_m1, ThermoFisher) and TNF-α (Mm00443258_m1 ...
-
bioRxiv - Neuroscience 2023Quote: ... 6-multiwell plate (ThermoFisher) in E8 medium containing 10 μM Y-27632 (#Y0503 ...
-
bioRxiv - Cell Biology 2024Quote: ... and 6% DMSO (Invitrogen). Each tissue organoid cryovial is barcoded with sample attributes and are assigned storage using RLIMS (Research Laboratory Information Management System) ...
-
bioRxiv - Pathology 2023Quote: ... using QuantStudio 6 (ThermoFisher). Relative mRNA levels were quantified by the ddCT method ...
-
bioRxiv - Neuroscience 2023Quote: ... interleukin 6 (Thermo Fisher Scientific ...
-
bioRxiv - Cancer Biology 2022Quote: ... IL-6 (Thermo Fisher), and IL-2 (BioLegend ...
-
bioRxiv - Cancer Biology 2024Quote: ... Essential 6 Medium (Gibco), 1% P/S ...
-
bioRxiv - Molecular Biology 2023Quote: ... 3 wells of a 6-well plate of mESC (corresponding to 6*10^6 cells approximately) were resuspended in 1 mL Trizol (Invitrogen,15596018) vortexed two times for 30 seconds and incubated 5 minutes at room temperature ...
-
bioRxiv - Biochemistry 2021Quote: ... The 5 mL HisTrap column was washed with 10 column volumes of wash buffer (2× GIBCO 14200-075 PBS, 5 mM Imidazole, pH 7.5) followed by 6 column volumes of elution buffer (2× GIBCO 14200-075 PBS ...
-
bioRxiv - Biochemistry 2024Quote: ... 300 μm × 5 mm, 5 μm, 100 Å, separation column: C18, Acclaim PepMap, 75 μm × 500 mm, 2 μm, 100 Å, Thermo Fisher Scientific). After loading the sample on the pre-column ...
-
bioRxiv - Cell Biology 2020Quote: ... Harvested equine explants were allowed to recover in 6-well plates for 3-7 days in the following control medium: DMEM/F12 medium (11330, Thermo Fisher Scientific, Waltham, MA), 10% fetal bovine serum (Seradigm 1500-500 ...
-
bioRxiv - Bioengineering 2021Quote: ... a 6 well plate containing 6 mL FACS Clean (Thermo Fisher, BD 340345), 6 mL FACS Rinse (Thermo Fisher ...
-
bioRxiv - Cell Biology 2021Quote: ... and labelled with 0.7 μM 6-carboxyfluorescin dictate (6-CFDA; Thermo Fisher Scientific) for 30 minutes at 37°C ...
-
bioRxiv - Neuroscience 2022Quote: ... high dose IL-6 stimulation received 100 ng/ml IL-6 (Gibco; PHC0066) or 100 pM acetic acid vehicle stimulation for either 3-or 24-hours and immediately collected for analysis ...
-
bioRxiv - Molecular Biology 2021Quote: For DNA plasmids: 5×106 HEK293T cells were grown in 6-well plates and Lipofectamine™ 3000 Transfection Reagent (L3000001, ThermoFisher UK) was used to transfect the cells following the manufacturer’s instructions ...
-
bioRxiv - Genomics 2020Quote: Exon 2 of A3A and exons 5 and 6 of A3B with either 20 or 80 bp of flanking intronic sequences were synthesized (Thermo Fisher Scientific) and cloned in sense orientation using XhoI and NotI restriction sites of Exontrap vector pET01 (MoBiTec ...
-
bioRxiv - Biochemistry 2021Quote: ... The mixture was left to equilibrate for 5 min at RT before 6 μL aliquots were placed in crystal-clear vials (Fisher Scientific UK) and snap-frozen in liquid nitrogen ...
-
bioRxiv - Microbiology 2021Quote: ... was introduced into 5 × 106 C6/36 mosquito cells per well of a 6-well plate via Lipofectamine 2000 reagent (Thermo Fisher Scientific), following the product’s instructions ...
-
bioRxiv - Developmental Biology 2022Quote: Mice were anesthetized using isoflurane and injected with 1% Biocytin-5(and-6-)- Tetramethylrhodamine (Biocytin-TMR: ThermoFisher Scientific; Waltham, MA, Cat# T12921). After 30 minutes in circulation ...
-
bioRxiv - Neuroscience 2021Quote: ... The specificity of this antibody has been previously validated by us and others by Western Blot, IF and IHC analyses (5, 6).The Anti-NeuN mouse monoclonal antibody (ThermoFisher MA5-33103) was used for IF ...
-
bioRxiv - Zoology 2022Quote: ... or 5,6,11-trideoxyTTX (10−5 M) together with a dextran conjugated with Alexa Fluor 555 (M.W. 10,000, 10−6 M; D34679, Thermo Fisher Scientific, MA, USA) for 5 min ...
-
bioRxiv - Immunology 2020Quote: ... or aged (26-28 mo) female C57BL/6 mice and cultured for 7 days at 37°C and 5% CO2 in DMEM (Gibco, 11995-073) supplemented with 10% FBS ...
-
bioRxiv - Microbiology 2021Quote: ... 5 x 105 HCT116 cells were seeded in a 6 well plate with Dulbecco’s modified Eagle medium (DMEM, Gibco®, Life Technologies) supplemented with 10% fetal bovine serum (FBS ...
-
bioRxiv - Molecular Biology 2022Quote: ... The syn-gRNA oligos and syn-gRNA-NTC were transfected using Lipofectamine RNAiMAX transfection reagent (5 µl per 6-well; Thermo Fisher Scientific) following the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2022Quote: ... C57BL/6 P4-5 mice pups were rapidly decapitated and brains were processed in Hibernate-A medium (Thermo Fisher Scientific, A12475-01). Resulting tissue was enzymatically disassociated in buffer containing HEPES-HBSS with DNase (Worthington Biochemical LS002007 ...
-
bioRxiv - Immunology 2022Quote: ... Media was removed from THP-1 monocytes cultures (5-6 x 105 cells/ml) and cells were washed once with DPBS (Thermo Fisher Scientifics). A total of 2 x 106 cells were resuspended in 50 μl of BTXpress solution and the Cas9-sgRNA complex was added ...
-
bioRxiv - Developmental Biology 2022Quote: ... NC cells were aggregated into 3D spheroids (5 million cells/well) in Ultra Low Attachment 6-well culture plates (Fisher Scientific, 3471) and cultured in Neurobasal (NB ...
-
bioRxiv - Biophysics 2024Quote: Quantitative determination of intracellular pH (pHi) was performed using the cell-permeant ratiometric pH indicator SNARF™-5F 5-(and-6)-carboxylic acid AM (Thermo Fisher) in live imaged N2a cells at 48 hours of differentiation ...
-
bioRxiv - Cell Biology 2024Quote: ... Cells were rinsed with serum-free RPMI-1640 medium before being transfected with 5 µL of siRNA pool (20 µM) and 5 µL Lipofectamine 2000 in a 6-well plate in 1 mL of antibiotic-free Opti-MEM (Gibco, #31985-062) medium plus 2 mL antibiotic-free cell-culture medium ...
-
bioRxiv - Cancer Biology 2023Quote: ... 5 × 105 cells were seeded in 6-well plates and immediately transfected with a mixture of 10 μL Lipofectamine2000 (Thermo Fisher Scientific), 6 μL of 20 μM target-specific siRNA (or non-targeting siRNA as control) ...
-
bioRxiv - Cell Biology 2023Quote: ... coated 6-well plates at 5×105 cells/well in RPMI 1640 with B27 and 10% knockout serum replacement (Thermo Fisher Scientific). Cells were expanded by culturing in RPMI 1640 with B27 with 2 μM of CHIR99021 (Stemcell Technologies) ...
-
bioRxiv - Biophysics 2022Quote: ... EVs were stained with 5-(and-6)-Carboxyfluorescein diacetate succinimidyl ester (CFDA-SE, hereinafter referred as CFSE) (Thermo Fisher, Catalog No. C1157) and separated as described previously [10] ...
-
bioRxiv - Genomics 2024Quote: ... using 5 μl/well (6-well plate) or 1 μl/well (24-well plate) of Lipofectamine 2000 transfection reagent (Thermo Fisher Scientific), following the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2020Quote: ... and probe E_Sarbeco_P1 (5′-FAM-ACACTAGCCATCCTTACTGCGCTTCG-BBQ-3′) using the TaqPath 1-Step Multiplex Master Mix kit (Applied Biosystems) on a QuantStudio 5 real-time PCR system (Appiled Biosystems) ...
-
bioRxiv - Developmental Biology 2021Quote: ... guide RNA for RBPMS2 (sequence 5’-GTCTTGCAGTGAGCTTGATC-3’) was synthesized using the T7 MegaShortScript transcription kit (Thermo Fisher Scientific). We previously described methods 28 to generate a doxycycline - inducible Cas9 line in the WTC-11 iPSC background (Coriell Institute) ...
-
bioRxiv - Molecular Biology 2022Quote: ... 5 nM biotinylated 685-bp DNA fragment (68% AT; Table S2) coupled to 3 μL M280 streptavidin dynabeads (ThermoFisher) was incubated with 5 nM prey DNA and H-NS in supplemented Filament Buffer at 5–8 μM 6:4 WT H-NS ...
-
bioRxiv - Molecular Biology 2020Quote: ... 3.125 μM Oligo-dT30VN (IDT, 5’AGCAGTGGTATCAACGCAGAGTACT30VN-3’) and 1:600,000 ERCC RNA spike-in mix (Thermo Fisher, 4456740)) into 384-well hard-shell PCR plates (Biorad HSP3901 ...
-
bioRxiv - Microbiology 2021Quote: ... Samples were washed 3 times with WB and nuclei were stained for 5 min with Hoechst 33342 (Life Technologies) in WB ...
-
bioRxiv - Biochemistry 2020Quote: ... The staining solutions contained 5 μM CM-H2DCFDA or 3 μM MitoSOX™ (both Thermo Scientific, MA, Waltham, USA) diluted in HEPES/HSA for the detection of intracellular or mitochondrial ROS ...
-
bioRxiv - Neuroscience 2020Quote: ... the slices were rinsed 3 times in PBS and incubated in PBS with DAPI (5 μg/ml, Invitrogen, #D1306) and the following secondary antibodies at 4°C for 24 h ...
-
bioRxiv - Microbiology 2020Quote: ... a DNA fragment comprising the entire coding region of kpfR plus approximately 550 pb of 3’ and 5’ flanking regions (Table S4 in the supplemental material) was inserted on pCR2.1-TOPO vector (Invitrogen) previously cloned with erythromycin-resistance gene ...
-
bioRxiv - Cell Biology 2021Quote: ... and lifted for 3 min at 37°C using 5 mL of TrypLE Express (Invitrogen, Gibco, Cat no. #1260501). The appropriate number of cells were then spun down at 90 x g for 10 min at room temperature ...
-
bioRxiv - Cell Biology 2021Quote: ... and lifted for 3 min at 37°C using 5 mL of TrypLE Express (Invitrogen, Gibco, Cat no. #1260501). The appropriate number of cells were then spun down at 90 x g for 10 min at room temperature ...
-
bioRxiv - Neuroscience 2022Quote: ... washed 3 times with PBS 5 min each and mounted on glass slides using Prolong Diamond antifade reagent (Invitrogen). We prepared antibodies in PBS containing 3% BSA ...
-
Molecular architecture determines brain delivery of a transferrin-receptor targeted lysosomal enzymebioRxiv - Neuroscience 2021Quote: ... Sections were then rinsed in 1xPBS/0.05% Tween for 3 rounds of 5 minutes and incubated in DAPI (Invitrogen Molecular Probes D1306 ...
-
bioRxiv - Neuroscience 2021Quote: ... slides were washed in 3×5’ PBS and incubated in goat-α-rabbit-555 (1:1000, Life Technologies, A21207) in PBS for 90’ ...
-
bioRxiv - Neuroscience 2020Quote: ... the sections were washed in 0.1 M TB (3 ×5 minutes) and then incubated in goat anti-chicken Alexa 488 (1:1000, #A11039, Invitrogen), goat anti-rabbit Alexa 568 (1:500 to 1:1000 ...