Labshake search
Citations for Thermo Fisher :
3701 - 3750 of 4593 citations for 6 Nitrochrysene since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2023Quote: Phosphor imaging of [γ-32P] radio-labelled DNA sequences was accomplished through 6% denaturing PAGE constituted of 1X TBE (89 mM Tris base, 2 mM EDTA and 89 mM boric acid, Fisher Scientific) (57) ...
-
bioRxiv - Molecular Biology 2023Quote: ... The resulting plasmid was used to transfect HEKR4 PTC reporter cells in 6-well plates with Lipofectamine 2000 (Invitrogen, Cat# 11668019) and PLUS™ Reagent (Invitrogen ...
-
bioRxiv - Physiology 2023Quote: ... Each cDNA sample was amplified with messenger RNA (mRNA) specific TaqMan Gene Expression Assays (IL-6, Mm00446190_m1; MCP-1, Mm00441242_m1; GAPDH, Mm99999915_g1; Thermo Fisher Scientific, Waltham, MA) on a CFX-96 real-time polymerase chain reaction (PCR ...
-
bioRxiv - Physiology 2023Quote: ... At 70-80% confluence cells were seeded into 6 well plates and were allowed to differentiate by replacing proliferation media to differentiation media [DMEM (Life Technologies) containing 2% HS (New Zealand origin ...
-
bioRxiv - Pathology 2022Quote: ... qRT–PCR was performed using qPCRBIO SyGreen Mix (Protech) and the QuantStudio™ 6 Pro Real-Time PCR System (Applied Biosystems/Thermo Fisher Scientific Inc. ...
-
bioRxiv - Neuroscience 2023Quote: ... neurons were dissociated and seeded (on coverslips inside a 6 well plate: 0.2E6 cells/well) onto plates containing NB plus [Neurobasal medium supplemented with B27 (Invitrogen GIBCO Life Technologies), GlutaMAX (GIBCO) ...
-
bioRxiv - Neuroscience 2022Quote: ... 3.5 cm) containing 30 larvae and a plastic-covered stirrer (magnetic stir bar micro PTFE 6 mm x 3 mm; Fisher Scientific) were placed on a magnetic stir plate (Variomag Poly 15 stirrer plate ...
-
bioRxiv - Neuroscience 2022Quote: ... the midbrain or cortical tissue from the 6-8 embryos were pooled together before digestion with Trypsin-EDTA 0.12% (Life Technologies, USA) for 7 min ...
-
bioRxiv - Neuroscience 2022Quote: ... Nuclear staining of glass-mounted brain sections was performed by 10 min incubation with PBS containing 2.5% DAPI (4’,6-diamidino-2-phenylindole, Thermo Fisher Scientific). Sections were embedded in mounting medium containing 1,4-diazabicyclooctane (DABCO ...
-
bioRxiv - Neuroscience 2022Quote: ... On day 6 in suspension the organoids were transferred to neural medium containing Neurobasal™-A Medium (Thermo Fisher Scientific, 10888022), B-27™ Supplement ...
-
bioRxiv - Molecular Biology 2022Quote: 100,000 LX2 or 20,000 RAW cells were seeded in 6- and 12-well tissue culture plates and allowed to grow for 24h in DMEM (GIBCO, Life Technologies) containing 10% FBS and antibiotics ...
-
bioRxiv - Neuroscience 2022Quote: ... along with a minus reverse transcriptase control (-RT) were ran for each gene on the QuantSudio 6 Flex Real-Time PCR System (Applied Biosystems). The -RT served as a negative control ...
-
bioRxiv - Neuroscience 2022Quote: ... 2 µg of plasmid and 6 µg of PEI were diluted in 0.5 mL of Opti-MEM™ Reduced serum medium (Gibco™) per single well ...
-
bioRxiv - Immunology 2022Quote: ... 100 μg of HDM or OVA were reconstituted in PBS with 0.1 M sodium bicarbonate at 1 mg/ml and mixed with 18 μg Texas Red-succinimidyl ester or 36 μg 5,(6)-TAMRA-succinimidyl ester (Life Technologies), respectively ...
-
bioRxiv - Immunology 2022Quote: ... Quantitative RT-PCR (RT-qPCR) was performed using the PerfeCTa SYBR green fastmix (Quantabio) on a QuantStudio 6 Flex real-time PCR instrument (Applied Biosystems). Normalized gene expression was calculated by comparative threshold cycle method using Actb as the endogenous housekeeping gene control ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... Syber green-based qPCR was performed using primer sets (Table S1) with 50 ng of cDNA from each sample in the QuanStudio-6 qPCR system (Applied Biosystems) with thermocycle condition ...
-
bioRxiv - Bioengineering 2022Quote: ... The carotid arteries were then washed with HEPES-PSS and submaximally constricted 10-15% using 10−6 M phenylephrine (207240100; Acros Organics). Vasodilation was measured by treating carotid arteries for five minutes with RBC-EVs isolated using exoEasy ...
-
bioRxiv - Plant Biology 2024Quote: ... Labeled peptides were separated into 6 fractions with Pierce™ High pH Reversed-Phase Peptide Fractionation Kit (Thermofisher, Cat. no. 84868) and dried in a Speed Vac at 45 °C for 3.5 hours ...
-
bioRxiv - Neuroscience 2024Quote: ... both retinas from either three (6-week-old) or two (12- or 18-week-old) fish were pooled and collected in Leibovitz 15 (L15, ThermoFisher Scientific) medium complemented with 2% Penicilin-Streptomycin (ThermoFisher Scientific) ...
-
bioRxiv - Bioengineering 2024Quote: ... at concentrations ranging from 1.6-16 mM for 90 minutes before being detached from the surface by treatment with 0.25 % trypsin-EDTA (Thermo Fisher Scientific). The detached cells were then centrifuged at 350 x g for 5 minutes ...
-
bioRxiv - Genetics 2024Quote: ... Barcoded beads were resuspended in lysis buffer (200 mM Tris-HCl pH8.0, 20 mM EDTA, 6% Ficoll PM-400 (GE Healthcare/Fisher Scientific), 0.2% Sarkosyl (Sigma-Aldrich) ...
-
bioRxiv - Neuroscience 2023Quote: ... NPCs to be terminally differentiated were passaged on three days after IL-6 stimulation (D21) into 50ng/ml poly-l-ornithine (Gibco; A3890401) and 20ng/ml laminin (Sigma ...
-
bioRxiv - Microbiology 2024Quote: ... and M2 THP-1 and TLat 1D5 MDMs were differentiated as described above and seeded directly in a 6-well glass bottom plate (ThermoFisher Scientific) at a density of 0.6x106 cells/mL ...
-
bioRxiv - Developmental Biology 2024Quote: ... and counterstained with 5 μg/mL of 4′,6-diamidino-2-phenylin-dole (DAPI) or propidium iodide (Molecular Probes, Life Technologies) for 10 min ...
-
bioRxiv - Molecular Biology 2024Quote: ... 293T human cells were seeded onto coverslips in a 6-well plate followed by transfection with the GFP plasmids noted above using Lipofectamine 3000 reagent (Thermo Fisher). For mitochondrial localization ...
-
bioRxiv - Developmental Biology 2024Quote: ... and counterstained with 5 μg/mL of 4′,6-diamidino-2-phenylin-dole (DAPI) or propidium iodide (Molecular Probes, Life Technologies) for 10 min ...
-
bioRxiv - Developmental Biology 2024Quote: Total protein was extracted from 1-2 wells of a 6-well plate using RIPA lysis buffer with protease inhibitor (ThermoFisher Scientific). Protein concentration was measured using Pierce BCA kit (ThermoFisher Scientific ...
-
bioRxiv - Cell Biology 2024Quote: ... 200 μg of total protein in a maximum volume of 50 μL was used for the Click-it reaction between Click-iT® HPG alkyne and Biotin Azide (PEG4 carboxamide-6-Azidohexanyl Biotin) (Invitrogen) was performed using Click-iT™ Protein Reaction Buffer Kit (Invitrogen) ...
-
bioRxiv - Cancer Biology 2024Quote: ... The samples were subjected to 6 rounds of 10 sec sonication each at power 3 in a 550 Sonic Dismembrator (Fisher Scientific). Between each round of sonication ...
-
bioRxiv - Neuroscience 2023Quote: ... Rosettes were plated on growth factor reduced matrigel coated 6 well plates in ‘pNPC medium’ composed of a 1:1 mixture of Neurobasal (ThermoFisher Scientific) and DMEM/F12 ...
-
bioRxiv - Genomics 2023Quote: ... for at least 6 hrs at 4 °C with rotation in 0.5 % BSA (Jackson Immunology, cat# 001-000-161) in PBS (Gibco, cat# 14190250), followed by blocking with 1% BSA in PBS for 1 hr at 4°C with rotation ...
-
bioRxiv - Microbiology 2023Quote: ... were used to amplify target genes and 18S rRNA primers were used to amplify endogenous control by using the QuantStudio 6 Flex RT-PCR system (Applied Biosystems). Relative quantities of viral and cellular RNA were calculated using the standard curve method 12,59.
-
bioRxiv - Physiology 2024Quote: ... prior to qPCR-based measurement of mRNA with SYBR green chemistry on a Quant-Studio 6-flex real-time PCR system (ThermoFisher Scientific). All data were normalized to Hprt1 or Actb by the 2-delta Ct method (100) ...
-
bioRxiv - Microbiology 2024Quote: A volume of 6 µl phosphopeptides or 500 ng of peptides were directly loaded onto reversed-phase pre-column (Acclaim PepMap 100, Thermo Scientific) and eluted in backflush mode ...
-
bioRxiv - Developmental Biology 2024Quote: Human TS cells were plated at 80,000 cells per well in 6-well tissue culture-treated plates coated with 5 μg/mL collagen IV (CB40233; Thermo Fisher) and incubated for 24 h ...
-
bioRxiv - Neuroscience 2024Quote: ... The lentiviral construct of interest was co-transfected with the packaging constructs pCMV-VSV-G and pCMV Gag/Pol at a ratio of 10 µg: 4 µg: 6 µg respectively using Lipofectamine 2000 (60 µL, Invitrogen 11668027). After 4 h ...
-
bioRxiv - Immunology 2024Quote: ... and vapA specific TaqMan™ primer and probe (Forward: GAGCAGCAGTACGACGTTCA; Reverse: GGCCCGAATACGTGAAACCT; Reporter: CAGCGCGGTCGTCTAC) in the instrument QuantStudio 6 Flex Real-Time PCR System (Applied Biosystems).
-
bioRxiv - Neuroscience 2024Quote: Determination of sIL-6R was performed in the FN of NL and 21 dpi of aged WT and GFAP-IL6Tg (n=3-6/experimental group) using a precoated mouse ELISA kit (EMIL6RA, Fisher Scientific) and following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2024Quote: ... 20-μl samples were assessed for thermal shifts in 96-well plates on a Quant Studio 6 Flex System (Applied Biosystems) using the melting curve setting and measuring fluorescence using the ROX reporter setting ...
-
bioRxiv - Microbiology 2024Quote: ... initial DNA libraries (including 6-12 degenerate NNK codons) were transcribed to mRNA using T7 RNA polymerase (37 °C, 16 hr) (Thermo Scientific) and ligated to a puromycin linker primer ([5’Phos]CTCCCGCCCCCCGTCC[SP18][SP18][SP18][SP18][SP18]CC[Puromycin] ...
-
Pyruvate kinase M2 regulates Japanese encephalitis virus replication by interacting with NS1 proteinbioRxiv - Microbiology 2024Quote: ... Neuro-2a cells were cultured on 6-well plates and then transfected with a total of 2 µg of an expression plasmid using Lipofectamine 2000 (Invitrogen, USA) as per the instructions provided by the manufacturer.
-
bioRxiv - Neuroscience 2024Quote: ... Concentration of each sample was adjusted to 2 μg/μl and then mixed with 6 X SDS-containing Laemmli buffer (ThermoFisher Scientific). Subsequently ...
-
bioRxiv - Neuroscience 2024Quote: ... membranes were transferred into clean 6-well plates with ice cold phosphate-buffered saline with magnesium and calcium (PBS-MC Gibco; 14040141). Somata were then dislodged from the upper surface of the membrane through gentle trituration with ice-cold PBS ...
-
The RNA-binding protein RbpB is a central regulator of polysaccharide utilization in gut BacteroidesbioRxiv - Microbiology 2023Quote: ... and the RNA product purified from a 6% (vol vol-1) PAA-7M urea gel using a LowRange RNA ladder (ThermoFisher Scientific) for precise sizing ...
-
bioRxiv - Cancer Biology 2024Quote: ... neurons were plated at a density of 0.8x106 cells per well of 6-well plates coated with 50 ug/mL Poly-D-Lysine (Thermofisher, #A38904-01) and 1ug/mL Laminin (Sigma ...
-
bioRxiv - Cell Biology 2024Quote: ... was developed over 17 min at a flow rate of 6 μl/min using an Ultimate 3000 capillary flow LC system (Thermo Scientific). Detection was performed with an ion trap mass spectrometer (Bruker amazon speed ETD ...
-
bioRxiv - Cancer Biology 2023Quote: ... and TNFα (10 ng/ml) for 6 h and stained for cleaved Caspase 3/7 green (5 µM) and propidium iodide (2 µM) (Thermo Scientific) for an additional 30 min ...
-
bioRxiv - Immunology 2024Quote: ... The amount of TNF-α and IL-6 in culture supernatants was quantified using commercial mouse ELISA kits (Thermo Fisher Scientific).
-
bioRxiv - Cell Biology 2024Quote: ... the conversion of non-fluorescent 2’,7’-bis-(2- carboxyethyl)-5-(and-6)-carboxyfluorescein acetoxymethyl ester (BCECF AM) (Invitrogen, Waltham, MA) into a pH sensitive fluorescent indicator by the intracellular esterase was used to measure the pH ...
-
bioRxiv - Cancer Biology 2024Quote: ... Eµ-Myc lymphoma cells grown in 6-well plates were spiked with 20 µM O-propargyl-puromycin (Thermo Fisher Scientific, C10459) for the final 30 min of the experimental period ...