Labshake search
Citations for Thermo Fisher :
3251 - 3282 of 3282 citations for GPX6 siRNA since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2023Quote: ... 5μl Lipofectamine® 2000 and 100 pm siRNA were respectively diluted in 200 μL Opti-MEM™ I Reduced Serum Medium (Thermo Scientific, 31985062) for 5 min at RT ...
-
bioRxiv - Cell Biology 2023Quote: siRNA probes targeting sfrp2 in human mesenchymal cells and frizzled-5 and -6 in AEC2 cells were obtained from Thermo Fisher (Supplemental Table 4). In brief ...
-
bioRxiv - Cancer Biology 2023Quote: ... were plated in 6 well plates and 24 h later each siRNA (17 nM) was transfected with Lipofectamine™ RNAiMAX (Thermo Fisher Scientific, 13778150) following manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2023Quote: ... Cultured cells at 50% confluence were transfected with siRNA at final concentrations of 50 nmol/L using the Lipofectamine RNAiMAX transfection reagent (Thermo Fisher Scientific, Waltham, MA) according to the manufacturer’s instructions.
-
bioRxiv - Neuroscience 2023Quote: Transient knockdown of NaV1.7 mRNA was done using short interfering RNA (siRNA) targeting both mouse and rat channel transcripts (Cat# 4390771, ID: s134909; Thermo Fisher Scientific Ambion, Waltham, MA, USA). Permanent knockout of endogenous NaV1.7 in ND7/23 cells was achieved using CRISPR/Cas9 genome editing with plasmid pD1301-AD (pCMV-Cas9-2A-GFP ...
-
bioRxiv - Cell Biology 2024Quote: ... hCMEC/D3 cells were plated in the plates or culture dishes at 6 × 104 cells/cm2 and transfected with 10 nM of negative control or human FOXO1 and ETS1 small interfering RNA (siRNA) (Tsingke Biotechnology, Beijing, China) for 12 h using Lipofectamine™ 3000 (Invitrogen, Carlsbad, CA, USA) reagent according to the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2023Quote: ... 150 000 cells/ml were transfected in suspension with the siRNAs (Supplementary Methods) and the Lipofectamine® RNAiMAX Transfection Reagent (Invitrogen, Thermo Fisher Scientific 13778) according to manufacturer’s instructions ...
-
bioRxiv - Bioengineering 2023Quote: ... HUVECs at passage 3 were transfected twice at 24 h-intervals with 30 nM siRNA and Lipofectamine RNAi max (Life Technologies, ref. 13778-150) according to the manufacturer’s instructions in OptiMEM at 37°C in a regular 5% CO2 in a humidified chamber ...
-
bioRxiv - Physiology 2024Quote: ... the LECs were grown to 60–80% confluence and transfected for 48 h with either control or CD36 Silencer® pre-designed siRNA as per the manufacturer’s instructions (ThermoFisher Scientific, Waltham, MA, USA). Cells were then serum starved for 1 h before insulin (100 nM ...
-
bioRxiv - Cancer Biology 2024Quote: Transfection was performed 24 h after seeding the cells into the wells using the DharmaFECT Transfection Reagent (Dharmacon, Lafayette, CO, USA) and Silencer® Select siRNA oligonucleotides (Ambion, Austin, TX, USA) listed in the Supplementary Table ...
-
bioRxiv - Immunology 2021Quote: ... cells were washed and fed with complete Lifeline medium with antibiotics and transfected with 100 nM 5′ tRNA-fMet1 half (#10620310, Invitrogen custom siRNA, Thermo Fisher Scientific) or 100 nM AllStars Negative Control siRNA (siNC ...
-
bioRxiv - Molecular Biology 2020Quote: ... 5nM (for double transfections) or 10nM (for single transfections) of each siRNA is forward transfected using Lipofectamine RNAiMAX Reagent (Thermo Fisher Scientific Catalog Number: 13778075) according to manufacturer’s instructions ...
-
bioRxiv - Genetics 2019Quote: We transfected 200,000 K562 CRISPRi cells (from the same population of cells that was used in the CRISPRi-FlowFISH screens) with siRNAs (from Ambion, Thermo Fisher Scientific, Table S4) using the Amaxa Nucleofector 96-well Shuttle (Lonza ...
-
bioRxiv - Molecular Biology 2021Quote: MCF-7 and MCF-10A cells were transiently transfected with the indicated siRNAs (Table S3) using Lipofectamine RNAi MAX (Thermo Fisher Scientific, Waltham, MA, USA), according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2020Quote: Gene-specific knockdown was achieved by reverse-transfection of PCa cell suspensions (total 5×105 cells) with 12.5 nM siRNA in 6 well plates using RNAiMAX transfection reagent (Life Technologies; Thermo Fisher Scientific, Scornsby, VIC, AUS), according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2022Quote: ... In mock experiments cells were transfected with equal amount of ON-TARGETplus Control Pool Non-Targeting pool (D-001810-10-05, Dharmacon, CO, USA) or Silencer Select Negative Control #1 siRNA (4390843, Ambion, Thermo Fisher Scientific, MA, USA). All plasmid transfections were performed using Nucleofactor Kit R with the Nucleofactor 2b Device (Lonza ...
-
bioRxiv - Neuroscience 2020Quote: ... Cells were seeded at a density of 8×105 cells on 35 mm tissue culture dishes and were transfected the following day with TDP43 siRNA using Lipofectamine™ 2000 (Invitrogen™, Life technologies Paisley, UK) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2019Quote: ... were purchased from Dharmacon (Thermo Scientific, Hemel Hempstead, UK. Cells were transfected with 25 nmol/L siRNA using Lipofectamine RNAiMax transfection reagent (Invitrogen, Life Technologies, Paisley, UK), following the manufacturer’s instructions.
-
Loss of p32 triggers energy deficiency and impairs goblet cell differentiation in ulcerative colitisbioRxiv - Molecular Biology 2020Quote: ... HT29-MTX cells were transiently transfected with 50 µM silencing RNA (siRNA) specific for human p32 (exon 3; s2138; Thermo Fisher Scientific, Waltham, Massachusetts, US) or control siRNA (Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2021Quote: ... A knockdown of a target gene was achieved with transfecting cells with specific siRNA (Table S2, Horizon Discovery, Lafayette, CO, USA) with Lipofectamine RNAiMAX reagent (Cat. 13778, Thermo fisher Scientific, Waltham, MA, USA) according to the manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2022Quote: ... the RNAi screen targeting 10,415 druggable genes (three individual siRNAs per gene) was conducted using OV90 cells and the Silencer® Select Human Druggable Genome siRNA Library Version 4 (Ambion Thermo Fisher Scientific, Waltham, MA), in absence or presence of bardoxolone methyl ...
-
bioRxiv - Cancer Biology 2022Quote: ... HNSCC cells were plated overnight in 10cm dishes and were transfected with siRNA duplexes (50 nM final concentration) using Lipofectamine RNAimax (Thermo Fisher Scientific, Grand Island, NY) for 72h (3 days ...
-
bioRxiv - Biochemistry 2023Quote: ... 150 000 cells/ml were transfected in suspension with the siRNAs (Supplementary Methods) and the Lipofectamine® RNAiMAX Transfection Reagent (Invitrogen, Thermo Fisher Scientific 13778) according to manufacturer’s instructions ...
-
bioRxiv - Systems Biology 2023Quote: ... or three different siRNAs (siRNA1: GCAGACAGAUUUCCUAGAAAU; siRNA2: GGUGUGUUCAAAGAGCAAAGA; siRNA3: GGCAAAUGAAGGAUUGAAACG) at a dose of 10 nM for 48 hours using Lipofectamine™ RNAiMAX (Thermo Fisher Scientific, Cat. 13778150). RNAs were then extracted from these cells using MagMAX RNA Extraction Kit (Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2023Quote: Reverse transfection of cells with ON TARGETplus siRNAs (Dharmacon, final concentration: 10 nM) was performed for 12 h with Lipofectamine™ RNAiMAX (Thermo Fisher Scientific, cat.no. 13778030) as described by the manufacturer ...
-
bioRxiv - Neuroscience 2020Quote: ... Cells were seeded at a density of 8×105 cells on 35 mm tissue culture dishes and were transfected the following day with TDP43 siRNA using Lipofectamine™ 2000 (Invitrogen™, Life technologies Paisley, UK) according to the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2022Quote: Hek293-Klotho cells were seeded at density of 200 000 cells/well on 12-well tissue culture plates and transfected with ARHGDIA Ambion™ Silencer™ Select Pre-Designed siRNA (4427038 Ambion, distributed through Thermo Fisher Scientific, Reinach, Switzerland) or with RhoGDI1 (ARHGDIA ...
-
bioRxiv - Systems Biology 2020Quote: ... Figure S5 shows the knockdown efficiency of siRNA transfections in each cell line with GAPDH siRNA compared to no siRNA (just N-TER transfection reagent) and negative control siRNA by Western blot (GAPDH antibody: Cell Signaling Technology, Cat#2118; Tubulin antibody: Thermo Fisher Scientific, Cat#62204). Experiments were performed 24hr after transfection.
-
bioRxiv - Cell Biology 2022Quote: ... Cells were seeded onto coverslips at 70% confluency and transfected with 50 nM of siRNA in two sequential transfections using Lipofectamine RNAiMAX (Life Technologies, Ref. # 13778-150, Lot # 2009103) in OPTI-MEM (Life Technologies ...
-
bioRxiv - Cell Biology 2023Quote: ... HUVECs were grown to ∼80% confluence followed by transfection with 100 nM human ERG Silencer Select (ID #s4811) or nontargeting siRNA oligos (Life Technologies: ERG #4392420 and nontargeting #AM4635) using lipofectamine RNAiMAX (Life Technologies ...
-
bioRxiv - Neuroscience 2023Quote: Transient knockdown of NaV1.7 mRNA was done using short interfering RNA (siRNA) targeting both mouse and rat channel transcripts (Cat# 4390771, ID: s134909; Thermo Fisher Scientific Ambion, Waltham, MA, USA). Permanent knockout of endogenous NaV1.7 in ND7/23 cells was achieved using CRISPR/Cas9 genome editing with plasmid pD1301-AD (pCMV-Cas9-2A-GFP ...
-
bioRxiv - Genomics 2022Quote: ... were transfected in 384-well plates (5000 cells per well) with siRNA or DPBS (mock control) at a final concentration of 50 nM using Invitrogen Lipofectamine® RNAiMAX (Invitrogen, Carlsbad, CA, Catalog No. 13778-150). After 48 hours ...