Labshake search
Citations for Thermo Fisher :
2801 - 2850 of 3282 citations for GPX6 siRNA since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2023Quote: ... #112322 for B3GALT6 or Silencer negative control No.1 siRNA AM4611) diluted to give a final concentration of 50 nM in Opti-MEM (Gibco) were performed on HUVECs at 30-40% confluency using Escort IV transfection reagent (L3287 ...
-
bioRxiv - Microbiology 2023Quote: ... cells were transfected with 100nM non-targeting control or individual kinase targeting On-TARGETplus SMARTPool siRNAs (horizon; Table S6) including four unique target sequences and 5µl RNAiMAX (ThermoFisher #13778150) in Opti-MEM (ThermoFisher #31985088 ...
-
bioRxiv - Cell Biology 2023Quote: ... cells were grown until 40% confluence and transfected with ON-TARGETplus SMARTpool siRNAs (Dharmacon) using Lipofectamine 3000 (Invitrogen, L3000-015). ON-TARGETplus Non-targeting pool (Dharmacon ...
-
bioRxiv - Molecular Biology 2023Quote: ... total RNA was extracted from control and Zmiz1 siRNA transfected HDLECs using GeneJET RNA Purification Kit (Thermo Fisher Scientific, K0732). RNA concentration and RNA integrity (RIN ...
-
bioRxiv - Molecular Biology 2023Quote: ... Penta KO ATG9A KO HeLa cells were transfected with siRNA against FIP200 (GGAAAUGUAUGAAGUUGCCAAGAAA) using Lipofectamine RNAiMAX (13778150; Thermo Fisher Scientific) for 4 h in Opti-MEM (31985-070 ...
-
bioRxiv - Cell Biology 2023Quote: ... and ON-TARGET plus Non-targeting Pool used as scrambled siRNAs (D-001810-10-20, Dharmacon) were transfected into ARPE-19 cells using Lipofectamine RNAiMax transfection reagent (13778075, Invitrogen). Three days after inducing cell cycle arrest ...
-
bioRxiv - Cancer Biology 2023Quote: ... HPAFII cells were serum-starved for 24 hours and then treated with control siRNA from Life Technologies or MUC1 siRNA from Perkin Horizon according to the respective manufacturer’s protocol using Lipofectamine RNAiMAX Transfection Reagent (Thermo Fisher Scientific) for 72 hours ...
-
bioRxiv - Molecular Biology 2023Quote: ... cells were transfected with the appropriate siRNAs (see Supplementary Table S3) using RNAiMax reagent (Invitrogen, Life Technologies, Carlsbad, CA, USA) according to the manufacturer’s protocol and harvested after 48 h or 72 h ...
-
bioRxiv - Cell Biology 2023Quote: ... cells were seeded in 12-well plates and transfected with FAM104 or control siRNA (25 or 50 nM final concentration) using 1.2 ul Oligofectamine (Thermo Fisher) diluted in 100 ul Opti-MEM (Thermo Fisher) ...
-
bioRxiv - Cancer Biology 2023Quote: ... cells were transfected with 10 nM of the indicated siRNA (Neg2: UGGUUUACAUGUUGUGUGA, MCAK siRNA1: ACCAUUACUGCGUUGGAUC [47], MCAK siRNA2: GAGAGCUCAGGAGUAUGACAGUAGU) with Lipofectamine RNAiMax (ThermoFisher) according to the manufacturer’s instructions in a total volume of 100 µL using Opti-MEM media (Invitrogen) ...
-
bioRxiv - Cell Biology 2023Quote: ... or 5’-TCAAGGTCCCTGATAATTATGGCGA-3’) or scrambled siRNA (non-targeting control) using 6 μL Lipofectamine™ RNAiMAX (Invitrogen™ - Cat.# 13778075). After 24 h ...
-
bioRxiv - Cell Biology 2023Quote: ... the ON-TARGETplus human Myo10 siRNA-SMARTpool from Dharmacon RNA Technologies (L-007217-00) was transfected into WT Hela cells using Lipofectamine RNAiMAX reagent (Invitrogen). To increase knockdown efficiency ...
-
bioRxiv - Molecular Biology 2023Quote: ... cells were transfected with the appropriate siRNAs (see Supplementary Table S3) using RNAiMax reagent (Invitrogen, Life Technologies, Carlsbad, CA, USA) according to the manufacturer’s protocol and harvested after 48 h or 72 h ...
-
bioRxiv - Cell Biology 2023Quote: ... MiniBAR-GFP sta-ble cell line was transfected with 25 nM of siRNAs targeting luciferase (5’-CGUACGCGGAAUACUUCGA-3’) or human Rab35 (5’-GCUCACGAAGAACAGUAAA-3’) using Lipo-fectamine RNAiMAX (Invitrogen), following the manufac-turer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: ... or control siRNA (ON-TARGETplus Non-targeting Control Pool, D-001810-10-05, Horizon Discovery) using Opti-MEM medium (31985070, Gibco). Knock-down of XPO1 mRNA and protein was verified after 24 h by RT-qPCR and immunoblot ...
-
bioRxiv - Systems Biology 2023Quote: ... MCF7 cells were plated at a density of 375,000 cells/cm2 and simultaneously transfected with siRNAs using Lipofectamine RNAiMAX (Thermo Fisher) using the reverse transfection protocol ...
-
The Hippo pathway terminal effector TAZ/WWTR1 mediates oxaliplatin sensitivity in colon cancer cellsbioRxiv - Cancer Biology 2023Quote: HCT116-shYAP/siTAZ cells were created by transfecting 100nM of TAZ siRNA (Dharmacon siGENOME SMARTpool #M-016083-00-0005) into HCT116-shYAP cells using Lipofectamine 2000 (Invitrogen) according to manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2023Quote: ... ON-TARGETplus PAFAH1B1 siRNA J- 010330-07-0002 (Dharmacon) or SMARTPool: ON-TARGETplus DYNC1H1 siRNA L-006828-00-0005 (Dharmacon) using Lipofectamine RNAiMax (ThermoFisher). Electroporations were performed 48 hours after siRNA transfection using the Neon Transfection System (ThermoFisher) ...
-
bioRxiv - Molecular Biology 2023Quote: Transient transfection of siTOP1 (Dharmacon; SMARTpool siRNA, L-005278-00-0005) and siSc (Dharmacon; D-00181010) was achieved using lipofectamine (ThermoFisher). Cells were seeded to reach a confluency of 60-70% on the day of transfection ...
-
bioRxiv - Cell Biology 2023Quote: MEFs were seeded onto 24 well dish and transfected with 15nM of DRP1 siRNA (Thermo Fisher Scientific, Silencer Select, 4390771), and negative siRNA (Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2023Quote: ... RPE-1 cells or MiniBAR-GFP stable cell lines were transfected with 25 nM of siRNAs targeting either luciferase or human Mini-BAR (5’-CUGCAAAUUUUACGGAUCA-3’) using Lipo-fectamine RNAiMAX (Invitrogen), following the manufac-turer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: ... HT1080 cells stably transduced with doxycycline-inducible MX2 or MX2T151A were reverse transfected with 25pmol of siRNA (Table 2; SMARTpool, Dharmacon) using Lipofectamine RNAiMax (Invitrogen) at a concentration of 5 x 104 cells/ml in 12-well plates ...
-
bioRxiv - Cancer Biology 2023Quote: ... 1×106 CRC cells were transiently transfected with 400 pmol siRNAs via electroporation by Neon Transfection System (Invitrogen, Carlsbad, CA) with 3 pulses of 10 msec at 1,600 V according to the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2023Quote: For gene silencing, siRNAs targeting the Blmh (Cat. # 100821 and s63474) or Phf8 gene (Cat. # S115808, and S115809) (Thermo Scientific) were transfected into cells maintained in Opti-MEM medium by 24-h treatments with Lipofectamine RNAiMax (Thermo Scientific) ...
-
bioRxiv - Biophysics 2023Quote: ... or 300 ng of ON-TARGETplus siRNA (Dharmacon, CO, USA) and 2 μl RNAiMax were prepared in OptiMEM (31985062, Gibco) according to the manufacturer’s instructions and pipetted onto 12-well plates (see Table S6 for full list of siRNAs used) ...
-
bioRxiv - Cancer Biology 2022Quote: ... Cells were seeded onto 6-well or 96-well plates for 24 hours and followed by siRNA (10 nM) transfection using Lipofectamine RNAiMAX (Invitrogen) according to the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2022Quote: ... A673 and MCF10A cells were transfected with 50 nM siRNAs (Table S7) using DharmaFECT reagent 1 and Gibco Opti-MEM I Reduced Serum Media (#31985047 ThermoFisher). Cells were harvested 72 h after transfection and analyzed by flow cytometry ...
-
bioRxiv - Cancer Biology 2023Quote: ... 10 pmol siRNAs were transfected using Lipofectamine RNAi MAX reagent (cat. no. 13-778-150; Invitrogen; Thermo Fisher Scientific, Inc.). Stealth RNAi Negative Control Medium GC (cat ...
-
bioRxiv - Cancer Biology 2023Quote: ... 10 pmol siRNAs were transfected using Lipofectamine RNAi MAX reagent (cat. no. 13-778-150; Invitrogen; Thermo Fisher Scientific, Inc.). Stealth RNAi Negative Control Medium GC (cat ...
-
bioRxiv - Cancer Biology 2023Quote: Reverse transfection of propionate metabolism-specific siRNAs was performed using Lipofectamine RNAiMAX transfection reagent as per manufacturer’s protocol (ThermoFisher Scientific). Briefly ...
-
bioRxiv - Cancer Biology 2023Quote: ... Dharmacon ON-TARGETplus siRNA SMARTPools against RHEB and HRAS were obtained from Horizon Discovery and transfected using Lipofectamine RNAiMAX (ThermoFisher).
-
bioRxiv - Cancer Biology 2023Quote: ... scrambled non-targeting (D-001210-01-05; siGENOME) and HD-PTP (PTPN23) siRNA (D-009417-01-0005; siGENOME; Horizon) were transfected using Lipofectamine RNAiMax reagent (Thermofisher). To generate stable HD-PTP knockdown cell lines we transduced SW1573 and H1299 cells with 3 individual HD-PTP shRNAs (LPP-HSH067569-LVRH1GH ...
-
bioRxiv - Cell Biology 2023Quote: NK cells were transfected with scrambled or ON-TARGET plus human WWTR1 SMARTpool siRNA from Dharmacon Inc, (CCGCAGGGCUCAUGAGUAU, GGACAAACACCCAUGAACA, AGGAACAAACGUUGACUUA, CCAAAUCUCGUGAUGAAUC) using the Neon Transfection System (Invitrogen) and according to the manufacturer recommended parameters ...
-
bioRxiv - Cancer Biology 2023Quote: ... NCI-H1299 cells were reverse transfected in 384 well plates with 20nM of Non-targeting control (NTC) or CEP89-targeting siRNA using Lipofectamine RNAiMax (ThermoFisher), according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2022Quote: Knockdown of CNTNAP4 in sarcoma cells was performed using Silencer Select chemically synthesized siRNA (Thermo Fisher Scientific, Cat# 4390846; s40010) 6 ...
-
bioRxiv - Molecular Biology 2023Quote: ... U2-OS-DR-GFP cells were co-transfected with an I-SceI plasmid plus the indicated expression vector or siRNA using Lipofectamine 2000 (Invitrogen) for 72 h ...
-
bioRxiv - Cancer Biology 2023Quote: Cells were cultured to approximately 60% confluency on 24-or 6-well plate and transfected with siRNAs at final concentrations of 10-25nM using lipofectamine RNAiMAX (Invitrogen) according to manufacturer’s instructions ...
-
bioRxiv - Genetics 2023Quote: THP1 cells were transfected with either the MeCP2 siRNA or negative control siRNA for 48 hours and then incubated with 2.5 µM CellTracker Green CMFDA (5-chloromethylfluorescein diacetate) (Invitrogen, C7025) for 30 minutes ...
-
bioRxiv - Cell Biology 2023Quote: Knockdown of BubR1 and Dynein heavy chain (DHC) was achieved by transfecting 150 pM siRNA using Lipofectamine RNAiMax (Thermo fisher) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2023Quote: ... siLuc (5′-CGUACGCGGAAUACUUCGAUUdTdT-3′) and siARP3 (SMARTpool siRNA L-012077-00-0010 (Dharmacon)) were transfected using RNAiMax (Thermo Fisher Scientific) according to manufacturer’s instruction.
-
bioRxiv - Cell Biology 2023Quote: ... For RNA interference experiments, cells were transfected with the corresponding siRNA (RAB11A, RAB11B, BLOC-1, KIF13A, KIF13B or Luciferase) using Lipofectamine RNAiMAX (Invitrogen), following the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2023Quote: HepG2 cells and HepG2DNAJB1-PRKACA clones were transfected in 96-well plate with 0.25-100 nM Silencer small interfering RNA (siRNA) (Negative Control: #1, CDK7: s2830) (Life Technologies) using Lipofectamine RNAiMAX transfection reagent (Life Technologies) ...
-
bioRxiv - Cancer Biology 2023Quote: ... 5 nM negative control siRNA or ACSL4 and ZEB2 siRNA (GenePharma) were transfected into MDA-MB-231 or paclitaxel-resistant cells using Lipofectamine 3000 (Invitrogen) according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2024Quote: All the siRNA-mediated knockdown experiments in primary human macrophages were performed by electroporation using a Neon Transfection System (MPK5000; Invitrogen). Each reaction used 1.2 – 1.5 x 106 hMDM ...
-
bioRxiv - Cancer Biology 2024Quote: ... c-Myc, and SIRT2 (ON-TARGET plus SMART pool siRNA, Dharmacon) were used with Lipofectamine RNAiMAX Transfection Reagent (#13778075, ThermoFisher). Knock-down and knock-in were confirmed by western blot.
-
bioRxiv - Cancer Biology 2024Quote: ... MCF-10A cells were transfected with the human ON-TARGET plus siRNA library targeting PHGDH (Dharmacon) or non-target control (Dharmacon) using the Neon Transfection System (Invitrogen). Then 96 hours post transcription ...
-
bioRxiv - Neuroscience 2023Quote: ... 5’-uaaggcuaugaagagauac-3’ while a silencer select negative control siRNA was used as a control for RGNEF (Catalog: 4390844, LifeTechnologies, ThermoFisher). Genes knock-down has been achieved through one round of silencing through Lipofectamine RNAiMAX (Invitrogen ...
-
bioRxiv - Neuroscience 2023Quote: ... Cells were transfected with siRNA or plasmids for desired time as detailed in the figure legends using Lipofectamine 3000 (L3000015, Invitrogen).
-
bioRxiv - Microbiology 2023Quote: ... Lipofectamine RNAiMAX:siST8Sia2 Mix (0.6 µL Lipofectamine:100 nM siRNAs) was formed in Opti-MEM (Thermo Fisher Scientific, Waltham, MA, USA) at room temperature for 20 min and added to SH-SY5Y cells in antibiotic-free medium for overnight transfection at 37 °C and 5% CO2 ...
-
bioRxiv - Molecular Biology 2023Quote: ... The cells were seeded in 6-well plates (2.25 x 10^5 cells per well) supplemented with 5 nM siRNA premixed with Opti-MEM Reduced Serum Medium (Gibco) and Lipofectamine RNAi Max Transfection Reagent (Thermo Fisher Scientific) ...