Labshake search
Citations for Thermo Fisher :
2401 - 2450 of 10000+ citations for rno mir 143 RT PCR Primer Set since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2024Quote: ... Standards for viral copy number were created by cloning PCR product using custom BdDV-1 primers into the pCR 2.1-TOPO vector using the TOPO TA cloning kit (Invitrogen). Transformed Escherichia coli colonies with successful insert were plasmid extracted using the Zyppy Plasmid Miniprep kit (Zymo Research) ...
-
bioRxiv - Bioengineering 2024Quote: ... and forward/reverse primers from IDT Technology in the QuantStudio™ 5 Real-Time PCR System (Applied Biosystems; A28574). The cycle was run 40 times at 95°C denaturation for 30 sec ...
-
bioRxiv - Cancer Biology 2024Quote: DNA was PCR-amplified and barcoded with P5/P7 primers (Integrated DNA Technologies) using Taq-Gold DNA polymerase (Thermofisher) according to the manufacturer’s instructions ...
-
bioRxiv - Bioengineering 2024Quote: ... and forward/reverse primers from IDT Technology in the QuantStudio™ 5 Real-Time PCR System (Applied Biosystems; A28574). The cycle was run 40 times at 95°C denaturation for 30 sec ...
-
bioRxiv - Molecular Biology 2024Quote: ... 0.25 µM of specific primers and 10 µl of Fast SYBR™ Green PCR Master Mix (Applied Biosystems; #4385612) in a total volume of 20 µl ...
-
bioRxiv - Cell Biology 2023Quote: ... PCR with primers p4 (5’ ATTTCAGTGG GACCTCAATGCC) and p5 (5’ GTGA CAGTCCAGGTGGAAACAAA) and Bpu10I digestion (Thermo Fisher Scientific #FD1184) was used to confirm the genomic differences between the KO + hTRIM28 and the KO + hTRIM28(S473A ...
-
bioRxiv - Microbiology 2024Quote: ... and Reverse primer: 3’-GGGCGGTAGTCGTAATTGTT-5’ were subjected to qRT-PCR for amplifying Amastin in QuantStudio 5 (Applied Biosystems) in triplicates ...
-
bioRxiv - Neuroscience 2022Quote: Entry plasmids containing specific coding DNA sequences were constructed by PCR from N2 cDNA with primers flanked with attB1 and attB2 recombination sites and cloned into pDONR_221 vector (Invitrogen) by BP recombination ...
-
bioRxiv - Molecular Biology 2022Quote: ... using gene-specific PCR primers (Supplemental Table S1) mixed with Power SYBR Green Master Mix (Thermo Fisher Scientific, 4367659) and diluted cDNA (10-fold dilution ...
-
bioRxiv - Physiology 2023Quote: ... TaqMan® Fast Universal PCR Master Mix and TaqMan assays (primers/probes) purchased from Life Technologies (Grand Island, NY). Reactions were run in duplicate on the QuantStudio-3 real-time PCR system (Applied Biosystems ...
-
bioRxiv - Cell Biology 2023Quote: ... qPCR was performed using TaqMan Fast Universal PCR mix and target (UTY) primer conjugated to FAM-probe (Hs01076483, ThermoFisher) with 18s rRNA primer (4319413E conjugated to VIC probe ...
-
bioRxiv - Synthetic Biology 2023Quote: ... the PRhaBAD promoter and CRISPR array with oriT spacer were amplified from pCas3cRh-oriT with tailed primers oriT_Cas3_F/R and the pSEVA521 backbone was linearized with Phusion PCR (Thermo Scientific) with tailed primers oriTcas3_SEVA_F/R (Table S1) ...
-
bioRxiv - Neuroscience 2023Quote: ... aliquots of single-stranded cDNA were amplified with gene-specific primers and Power SYBR Green PCR Master Mix (Invitrogen) using the CFX96™ real time PCR detection system (Bio-Rad) ...
-
bioRxiv - Cell Biology 2023Quote: ... quantitative PCR (qPCR) was performed using a gene-specific primer utilizing Powerup SYBR green master mix (Applied Biosystems # A25742). Fold change (2-ΔΔCt ...
-
bioRxiv - Immunology 2024Quote: ... using the forward and reverse primers listed in Dataset EV5 in the 7300 Real-Time PCR System (Applied Biosystems). Relative gene expression was calculated with the ΔΔCt method ...
-
bioRxiv - Cell Biology 2024Quote: ... genome and SeV-carried pluripotency genes in iPSCs occurred through PCR using cDNA from each iPSC line and primers provided by the CytoTune-iPS 2.0 Sendai Reprogramming Kit (Invitrogen). PCR was also performed on cDNA from each iPSC line in order to detect expression of pluripotency markers SOX2 ...
-
bioRxiv - Immunology 2024Quote: ... using specific forward and reverse primers listed in Table EV1 in a 7300 Real-Time PCR System (Applied Biosystems). The relative gene expression was calculated with the ΔΔCt method (Livak & Schmittgen ...
-
bioRxiv - Molecular Biology 2021Quote: ... with differently labeled probe sets (Life Technologies) allowing to use renilla counts as an internal control ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... NED and HEX sets (Applied Biosystems, Tokyo). As for PCR ...
-
bioRxiv - Immunology 2020Quote: ... IL-13 (Ready-SET-go, ThermoFisher Scientific) and IL-33 (Duoset ...
-
bioRxiv - Immunology 2021Quote: ... Cell Sorting Set-up Beads (Life Technologies) were used to quantify and normalized cell number between samples and experiments ...
-
bioRxiv - Cell Biology 2021Quote: ... Pre-designed probe sets (Thermo Fisher Scientific) were used as follows ...
-
bioRxiv - Immunology 2022Quote: ... or the Fix/Perm buffer set (Invitrogen) according to the manufacturer’s protocol ...
-
bioRxiv - Developmental Biology 2022Quote: ... we set-up TaqMan assays (ThermoFisher Scientific) in 96-well plates ...
-
bioRxiv - Molecular Biology 2024Quote: ... The default probe sets defined by Affymetrix were used to assess array quality using the Area Under the [Receiver Operating Characteristics] Curve (AUC ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... and treat with PureLink DNase set (Invitrogen). RNA samples were quantified by measuring absorbance at 260nm with the Qubit RNA HS assay kit ...
-
bioRxiv - Cancer Biology 2023Quote: ... with DNase set (12185010, Thermo Fisher Scientific). The Agilent Bioanalyzer confirmed that the RIN counts of the RNA samples were greater than >8.5 ...
-
bioRxiv - Microbiology 2023Quote: TMTpro 16plex Label Reagent Set (Fisher Scientific) was used for isobaric labeling as directed by the manufacturer26 ...
-
bioRxiv - Molecular Biology 2023Quote: ... 5 mM NTP Set (Thermo Fisher, R0481), 0.2 units yeast inorganic pyrophosphatase (NEB) ...
-
bioRxiv - Microbiology 2020Quote: ... Primers and probes were designed using the Primer Express Software (Applied Biosystems) and purchased from Integrated DNA Technologies ...
-
Regulation of skeletal muscle metabolism and contraction performance via teneurin-latrophilin actionbioRxiv - Physiology 2021Quote: ... 2 μL forward primer and 2 μL reverse primer (Invitrogen; Table 1), 14.2 μL water (Sigma ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... Primers and probes were designed using the Primer Express Software (Applied Biosystems).
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... Primers were designed using the Primer Express 3.0 software (Thermo Fisher Scientific). GAPDH-F CCATCACCATCTTCCAGGAGCG ...
-
Unbiased transcriptomic analysis of chondrocyte differentiation in a high-density cell culture modelbioRxiv - Developmental Biology 2021Quote: Primers for amplification were designed using Primer Express 3 software (Applied Biosystems) described in Kruger et al ...
-
bioRxiv - Microbiology 2020Quote: ... Primer design was done using Primer express software v3.0.1 from Thermo Fisher Scientific (Waltham ...
-
bioRxiv - Microbiology 2022Quote: ... All primers were designed using the Primer Express 2.0 software (Applied Biosystems). The pair of primers ABCC2_CNV_F 5’-TGGCATCATTTATGTGGCTGTT-3’ and ABCC2_CNV_R 5’-AGGAAGGAGCTTGGGCTTTTA-3’ amplify a specific region of the ABCC2 gene containing the CNV ...
-
bioRxiv - Genetics 2023Quote: ... Extracted DNA was amplified using primers targeting COI (Invitrogen, LCO (forward primer): GGTCAAATCATAAAGATATTGG ...
-
bioRxiv - Molecular Biology 2024Quote: ... and 100 μM random primer was added (Invitrogen Random Primers 48190-011); 10XPhi29 MAX DNA Polymerase Reaction Buffer was supplemented with Nuclease-free ddH2O to 8.5μL ...
-
bioRxiv - Developmental Biology 2021Quote: Total RNA was reverse-transcribed into cDNA using a SuperScript III First-Strand Synthesis System for RT-PCR (Invitrogen). PCR was conducted with primer sets (Table S1 ...
-
bioRxiv - Developmental Biology 2021Quote: ... Total RNA was reverse-transcribed into cDNA using a SuperScript III First-Strand Synthesis System for RT-PCR (Invitrogen). The amplification conditions for PCR were 2 min at 50°C ...
-
bioRxiv - Molecular Biology 2020Quote: ... Quantitative RT-PCR analysis was performed using the Power SYBR Green RNA-to-Ct 1-Step kit (Applied Biosystems) according to the manufacturer’s instructions ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... We performed quantitative RT-PCR on an Applied Biosystems StepOnePlus machine using Fast SYBR Green Master Mix (Applied Biosystems). We used a 10 μL reaction containing 1.5 μL of 1:1 diluted cDNA ...
-
bioRxiv - Microbiology 2022Quote: ... Real-time RT-PCR was performed with the Power SYBR Green RNA-to-CT 1-Step Kit (Applied Biosystems) using a AriaMx Real-Time PCR system (Agilent) ...
-
bioRxiv - Microbiology 2022Quote: ... Real-time RT-PCR was performed with the Power SYBR Green RNA-to-CT 1-Step Kit (Applied Biosystems) using a AriaMx Real-Time PCR system (Agilent).
-
bioRxiv - Genomics 2020Quote: cDNA samples were generated from the isolated mRNA using SuperScript IV One-Step RT-PCR System (Thermo Fisher Scientific) according to the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2019Quote: ... Cells were sorted in RT-STA reaction mix from the CellsDirect™ One-Step qRT-PCR Kit (Life Technologies), reverse transcribed and specific target pre-amplified (20 cycles) ...
-
bioRxiv - Molecular Biology 2019Quote: ... RT-PCR was performed on 3.5 µl of DNA using the platinum SYBR green qPCR superMix-UDG kit (Invitrogen) according to manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2019Quote: ... First strand cDNA was prepared from total RNA using Superscript III First-strand Synthesis System for RT-PCR (Invitrogen). Transcript abundance of the cyp4g16 and cyp4g17 genes were examined using two sets of primers for each gene in order to monitor reliability of amplification (details in Table S1) ...
-
bioRxiv - Cancer Biology 2020Quote: ... Quantitative real-time RT-PCR was used to quantify RNA and microRNA expression using SYBR Green reagents (Applied Biosystems) and microRNA with TaqMan™ Universal Master Mix II (Applied Biosystems ...
-
bioRxiv - Neuroscience 2020Quote: ... array of 48 different mouse genes using a Step One Plus RT PCR system (Applied Biosystems, Foster City, CA) modified based on a previously published array of oxidant/antioxidant genes ...