Labshake search
Citations for Thermo Fisher :
2601 - 2650 of 10000+ citations for rno mir 143 RT PCR Primer Set since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2021Quote: ... qPCR was performed using 50 ng or 1.5 µl of template DNA and 0.5 µM primers with SYBR Green PCR Master Mix (Thermo Fisher Scientific) in FrameStar 96-well PCR plates (4titude) ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... and reverse (5’-ACAGGACATTGACCAACCCA-3’) primers (0.3μM) and 1X premixed Phusion Flash High-Fidelity PCR Master Mix (Thermo Scientific, France). Amplifications were carried out in a thermal cycler LifeEco (BIOER Technology ...
-
bioRxiv - Genetics 2022Quote: ... The blasticidin resistance gene coding sequence was amplified by PCR with the primers BlasS SacII F1 and BlasS BamHI R3 from pcDNA6/V5-His-A (Invitrogen):
-
bioRxiv - Genetics 2022Quote: ... as per manufacturer’s instructions and with primers (Supplemental Table 1) on the StepOne-Plus Real-Time PCR System (Applied Biosystems). Relative mRNA expression was calculated using the comparative CT method [21] with the StepOne Software v2.3 (Applied Biosystems ...
-
bioRxiv - Neuroscience 2019Quote: ... PerfeCTa SYBR Green FastMix (Quantabio) and 0.5 µM of gene-specific primers (Table. S3) in a 7500 Fast Real-Time PCR System (Applied Biosystems), calculating relative expression using the ΔΔCt method [58] with cdc-42 and Y45F10D.4 as reference genes [59].
-
bioRxiv - Bioengineering 2019Quote: ... and T7 Trilink-modified reverse primers using the Maxima Hot Start Green PCR Master Mix (2X) (Thermo Fisher Scientific, USA). iv ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... PCR was conducted using a 5’ fluorescently-labelled primer (6-FAM, PET, NED, or VIC) (Applied Biosystems, Foster City, CA) and an unlabeled reverse primer ...
-
The Arabidopsis F-box protein FBW2 degrades AGO1 to avoid spurious loading of illegitimate small RNAbioRxiv - Cell Biology 2021Quote: ... The FBW2 coding sequence as well as AGO1 NT-PAZ and AGO1 L2-CT were amplified by PCR using primers listed in Table S3 and used for gateway recombination using pDONR-Zeo plasmid (Invitrogen). Then ...
-
bioRxiv - Developmental Biology 2019Quote: ... The ERlucT-IRES-Rluc bicistronic expression cassette was then PCR amplified using primers listed in Table 1 and then subcloned using the pCR8/GW/TOPO TA Cloning Kit (Invitrogen), to produce the Gateway cloning-compatible ERlucT-IRES-Rluc-pCR8 middle entry vector ...
-
miRNA activity contributes to accurate RNA splicing in C. elegans intestine and body muscle tissues.bioRxiv - Molecular Biology 2019Quote: ... The entire cassette was then PCR amplified with Gateway-compatible primers and cloned into pDONR P221 by Gateway BP Clonase reactions (Invitrogen).
-
bioRxiv - Evolutionary Biology 2019Quote: ... and 0.5 µM of Oligo 17 (Supplementary File 2) as forward and reverse primers in 1x PCR buffer (Thermo Scientific), 0.2 mM dNTPs ...
-
bioRxiv - Genomics 2019Quote: ... 300 nM of each primer and 3.75 μL of cDNA 1:4 diluted on a QuantStudio 12K Flex Real-Time PCR System (Applied Biosystems). To evaluate the efficiency of the RT-qPCR assays ...
-
bioRxiv - Molecular Biology 2021Quote: ... Reverse transcription with random primers and subsequent PCR were performed with TaqMan RNA-to-CT 1-Step Kit (Applied Biosystems). All experimental groups were assessed as 6 technical replicates and repeated at least three times.
-
bioRxiv - Cell Biology 2020Quote: ... Hygromycin B resistance cassette was amplified by PCR (primer sequences available upon request) and inserted into KpnI-digested pLenti6.2/V5-DEST (Invitrogen, V36820), replacing the Blasticidin resistance cassette (pLenti6.2_Hygro/V5-DEST) ...
-
bioRxiv - Immunology 2020Quote: ... 2µl of cDNA was used in 12µl qPCR reactions with appropriate primers and SYBR Green PCR Master Mix (Applied Biosystems). Data were analyzed by ddCT method ...
-
bioRxiv - Microbiology 2020Quote: ... One-step RT-qPCR was performed with primers targeting the SARS-CoV-2 N region (BEI) using the EXPRESS One-Step Superscript qRT-PCR Kit (ThermoFisher) on an Applied Biosystems QuantStudio3 instrument ...
-
bioRxiv - Microbiology 2020Quote: ... Full length P genes were amplified by reverse transcriptase PCR using gene-specific primers and Superscript II reverse transcriptase (Invitrogen). These were then cloned into pcDNA3.1 at KpnI-BamHI sites and designated pP ...
-
bioRxiv - Genomics 2021Quote: ... The lce.2 cDNA was amplified from the reverse transcribed template via PCR (see primer sequences in Supplementary Text 1) and inserted into a TOPO TA cloning kit vector (Invitrogen) according to manufacturer’s instructions ...
-
bioRxiv - Genetics 2020Quote: ... gins2 cDNA was cloned using primers gins2-F – 5’-CTCCTTGACGTCAGAGACACAT-3’ and gins2-R – 5’-GGAGAGGAATGGCTGAAGTACC-3’ into pCR-Blunt II-TOPO vector (Invitrogen) following the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2020Quote: ... Up to 1μg of fragments were ligated to adaptor primer pairs overnight at 16° and cleaned (GeneJET PCR Purification, Thermo Fisher) before second-strand synthesis with Taq polymerase (NEB ...
-
bioRxiv - Microbiology 2022Quote: ... trachomatis L2 genomic DNA by PCR with primers that added restriction sites on each end using AccuPrime Pfx DNA Polymerase (Invitrogen). DNA was extracted by gel purification using the Qiaquick Gel Extraction Kit (Qiagen) ...
-
bioRxiv - Biochemistry 2022Quote: ... PerfeCTa SYBR Green FastMix (Quantabio) and 0.5 μM of gene-specific primers in a 7500 Fast Real-Time PCR System (Applied Biosystems), calculating relative expression using the ΔΔCt method (Livak and Schmittgen ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... was mixed with 0.5 μM of respective forward and reverse primers (see Supplementary Table 1) in 1X PCR buffer (Thermo Scientific), 0.2 mM dNTPs ...
-
bioRxiv - Neuroscience 2022Quote: ... 376-bp product amplified by PCR using the Exon5-F1 and Exon5-RC1 primer pair was cloned into TOPO-TA vector (Invitrogen), and plasmids were sent for sequencing ...
-
bioRxiv - Microbiology 2022Quote: ... qPCR was performed in triplicate using gene-specific primers with SYBR Green PCR Master Mix (Thermo Fisher Scientific catalog # 4309155) in QuantStudio 5 Real-Time PCR machine (Applied Biosystems) ...
-
bioRxiv - Neuroscience 2022Quote: ... All AAVs were measured relative to standards with primers targeted to the ITRs (forward: 5′-GGAACCCCTAGTGATGGAGTT, reverse: 5′-CGGCCTCAGTGAGCGA) with the SYBR Green PCR Master Mix (ThermoFisher). qPCR was performed on the StepOnePlus real-time PCR system ...
-
bioRxiv - Physiology 2022Quote: ... Pre-amplification step was performed using FAM-labeled specific PCR primers 20X and TaqMan PreAmp Master Mix kit (Applied Biosystems) for 12 cycles ...
-
bioRxiv - Neuroscience 2022Quote: RNA in 2X SuperScript III buffer was incubated for 1 min at 50 °C on a PCR cycler with 2.5 μl of the following mix: 1.5 μg Random Primer (Invitrogen, 48190-011), 10 μM Oligo d(T)20 primer (Invitrogen ...
-
bioRxiv - Neuroscience 2024Quote: ... Genes were amplified using forward and reverse primers and detected using Power Up Sybr Green reagent in a Quant Studio 3 Real-Time PCR system (ThermoFisher). Ct values were calculated and relative express was quantified using GAPDH expression as a reference control ...
-
bioRxiv - Neuroscience 2024Quote: ... and quantifying mPFC Crh gene expression two and four weeks later by means of TaqMan qRT-PCR using Crh primer Rn01462137_m1 (Thermo Fisher), normalized to Gapdh expression (Supplementary Fig.6.).
-
bioRxiv - Microbiology 2024Quote: ... and 50 ng of purified DNA was mixed with 0.3 µM of omcB forward and reverse primers with Power SYBR Green PCR Master Mix (Applied Biosystems). The qPCR reactions were run on a QuantStudio 3 (Applied Biosystems) ...
-
bioRxiv - Biochemistry 2023Quote: Plasmids for recombinant protein expression were constructed using mega primer insertion PCR [64] using the plasmid Champion pET303/CT-His vector (Invitrogen). The double-stranded DNA inserts (Integrated DNA Technologies ...
-
bioRxiv - Cell Biology 2024Quote: ... two nested RACE PCRs (primer combinations listed in Table S1) using cDNA attached to oligo (dT)25 Dynabeads (ThermoFisher Scientific) as a template ...
-
bioRxiv - Developmental Biology 2024Quote: ... and qRT-PCR was performed with primers listed in the Supplementary Table 1 and TaqMan 2X master mix (Applied Biosystems/Life Technologies ...
-
bioRxiv - Evolutionary Biology 2023Quote: Coding sequences of pifA and pifB were PCR amplified from wTpre-infected wasps using modified forward primers to facilitate cloning into pENTR-D/TOPO (Invitrogen). These constructs were transformed into One Shot Top10 competent cells (Invitrogen ...
-
bioRxiv - Plant Biology 2023Quote: ... 2000 bp upstream of the PIF7 start codon were amplified by PCR using the primers listed in Supplementary Table S1 and cloned into the pDONR P4-P1R vector (Invitrogen) by Gateway BP recombination reaction (Invitrogen) ...
-
bioRxiv - Immunology 2023Quote: ... DC-SIGN) genes were amplified by PCR with gene-specific primers (Suppl. Tab. 2) using Phusion High-Fidelity Master Mix (ThermoFisher). PCR products were digested with AgeI and NheI ...
-
bioRxiv - Cancer Biology 2023Quote: ... The relative expression of targeted genes was measured by qRT-PCR with indicated primers and SYBR Green Master Mix (ThermoFisher) using the ABI 7500 Real-Time PCR Detection System (Applied Biosystems) ...
-
bioRxiv - Cancer Biology 2023Quote: The fragment size distribution during TMZ selection was assessed using a 6-carboxyfluorescein-labeled reverse primer in a PCR assay and a GA3500 genetic analyzer (ThermoFisher).
-
bioRxiv - Biophysics 2023Quote: ... The left biotinylated arm with 6.6 kbp was amplified from plasmid pDRM1 (a kind gift from Daniel Ramírez-Montero) by PCR using primers HS_BN47 and HS_BN48 (ELLA Biotech) with Platinum SuperFi II DNA Polymerase (Thermo Scientific #12361010). The right biotinylated arm with 3.3 kbp was amplified as above from plasmid pDRM1 using primers HS_BN45 and HS_BN46 (ELLA Biotech) ...
-
bioRxiv - Neuroscience 2023Quote: ... Gene-specific primers were designed to amplify a PCR product that was recombined with middle donor vector (Table 2; Invitrogen Gateway pDONR221 Cat No ...
-
bioRxiv - Immunology 2023Quote: ... PCR products were sequenced with the reverse primer CHG-D1 and read on ABI PRISM 3130XL genetic analyzer (Applied Biosystems). Sequence quality was verified using CodonCode Aligner software (CodonCode Corporation).
-
bioRxiv - Plant Biology 2023Quote: ... were amplified from Petunia x hybrida R27 genomic DNA with primers from Table S1 and cloned into pCR-BluntII-TOPO (ThermoFisher). Binding sites were amplified from these plasmids with primers listed in Supplementary Table 1 ...
-
Disruption of the Aspergillus fumigatus RNA interference machinery alters the conidial transcriptomebioRxiv - Microbiology 2023Quote: ... 10 pmol of each primer and 25 μl of 2x Phusion Flash High-Fidelity PCR Master Mix (Thermo Fisher Scientific). Both ...
-
bioRxiv - Plant Biology 2023Quote: ... All the primers for the real-time PCR analysis were designed using the ‘Primer Express 2.0’ software (expected product size = 100–120 bp) (Life Technologies) followed by the individual pair confirmation using the BLAST program in the RGAP database (rice.plantbiology.msu.edu ...
-
bioRxiv - Molecular Biology 2023Quote: ... 1 µL of the reverse transcription reaction was used to amplify regions of interest using gene-specific primers in a 50 µL PCR reaction using recombinant Taq DNA Polymerase (Invitrogen) (see Table S2) ...
-
bioRxiv - Microbiology 2023Quote: ... Material was subject to on-bead PCR using primers am954/956 using the Platinum SuperFi II Mastermix (ThermoFisher/Life Technologies) for 15 cycles ...
-
bioRxiv - Microbiology 2023Quote: ... Material was subject to on-bead PCR using primers am954/956 using the Platinum SuperFi II Mastermix (ThermoFisher/Life Technologies) for 15 cycles ...
-
bioRxiv - Developmental Biology 2023Quote: ... 2 picomol/μl of each primer per reaction in 10μl of final volume in ABI 7500 real-time PCR machine (Applied Biosystems). The relative fold change in mRNA expression for different genes was calculated using the comparative CT method to assess changes in gene expression ...
-
bioRxiv - Microbiology 2024Quote: ... the rsmA gene was amplified by PCR using the rsmAF: ATGGTTAAAGCAAAAAAACAATACGGAC and rsmAR: TTATTTATCTCTTTGTTTTCGTCCATATTTATC primers and cloned into the pJET1.2 plasmid (ThermoFisher Scientific), prior to insertion of the cat cassette [51] using the primers rsmA_mutR ...