Labshake search
Citations for Thermo Fisher :
2251 - 2300 of 10000+ citations for rno mir 143 RT PCR Primer Set since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genetics 2022Quote: ... Sanger sequencing was performed directly on 1µL of PCR reaction in the presence of 5µM primer and the Big Dye Terminator V3.1 (Applied Biosystems™). The following thermocycler program was used ...
-
bioRxiv - Microbiology 2019Quote: ... The synthesized cDNA was mixed with specific primers for each segment in SYBR Green PCR Master Mix (Applied Biosystems) and the reaction performed on a 7900HT Fast Real-Time PCR System (Applied Biosystems).
-
bioRxiv - Microbiology 2019Quote: ... qPCR reactions were performed in triplicate using specific primers and the Power SYBR Green PCR Master Mixture (Applied Biosystems) in a Viia7 Applied Biosystems Light-cycler ...
-
bioRxiv - Pathology 2019Quote: ... INF2 was then PCR amplified from cDNA using isoform-specific primers (Supplementary Figure 1) (Accuprime DNA Polymerase system, ThermoFisher). The PCR amplified product was gel-purified and examined for INF2-isoform-specific sequences using DNA sequencing (Genewiz).
-
bioRxiv - Genetics 2019Quote: ... DNA was PCR amplified for 12 cycles with Illumina primers PE1.0 and PE2.0 and Phusion DNA polymerase (1 unit, Thermo Scientific). Six PCR reactions were pooled for each library ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... and 1.0 µl was used as a template for a second round of amplification with 1.0 µM of the same degenerate primers using the Platinum Hot Start PCR Master Mix (Invitrogen). Thermocycler conditions were 94°C for 5 min ...
-
bioRxiv - Immunology 2019Quote: ... qPCR was performed with primers against the Hh cdtB gene using a Viia7 Real-Time PCR system (Applied Biosystems) as described by Maloy et al. ...
-
bioRxiv - Neuroscience 2021Quote: Genotyping and CAG repeat sizing were performed by PCR of ear-biopsy DNA and all primers were from Invitrogen. For zQ175 mice ...
-
bioRxiv - Plant Biology 2022Quote: ... and specific DNA primers (SI Appendix, Table S4) in a StepOnePlus Real-Time PCR system (Applied Biosystems, CA, USA) using SYBR GreenER qPCR Super Mix (Invitrogen ...
-
bioRxiv - Genomics 2019Quote: ... PCR reactions were performed using MEL_015 and MEL_016 specific primers and one unit of Phusion DNA Polymerase (Thermo Scientific) in a 50 μl final volume.
-
bioRxiv - Molecular Biology 2021Quote: ... Lysosomal ExRai AMPKAR was made by inserting PCR-amplified LAMP149 generated using primers 7-8 into HindIII (ThermoFisher FD0504)/BamHI-digested ExRai AMPKAR backbone ...
-
bioRxiv - Microbiology 2020Quote: ... 10pmol of each the forward and the reverse primers: (HAV1; 5’ - GCTCCTCTTTATCATGCTATGGAT-3’ and rHAV2; 5’-CAGGAAATGTCTCAGGTACTTTC-3’) and 12.5μl of PCR Reddy master mix (Thermo Scientific). PCR products (6μl ...
-
bioRxiv - Microbiology 2020Quote: ... 10pmol of each the forward and the reverse primers: (HAV1; 5’ - GCTCCTCTTTATCATGCTATGGAT-3’ and rHAV2; 5’-CAGGAAATGTCTCAGGTACTTTC-3’) and 12.5μl of PCR Reddy master mix (Thermo Scientific). PCR products (6μl ...
-
bioRxiv - Developmental Biology 2022Quote: ... and ret51 (ENSDART00000077627.7) splice variants were amplified from cDNA libraries using forward (GGCTCCTTTCGCTCGAATCA) and reverse (ACACTCAGCTTAATGTAGTTATTGTTGCAC) primers and Phusion PCR (Invitrogen). ret9 and ret51 splice variant amplicons were cloned into pCR-Blunt II-TOPO vector using manufactures instructions (Invitrogen ...
-
bioRxiv - Microbiology 2022Quote: ... PCR was performed using flanking primers mentioned in Table S1 to screen candidate colonies using Dreamtaq Master Mix (ThermoFisher). PCR products were analyzed by agarose gel electrophoresis and Sanger sequencing (Genewiz ...
-
bioRxiv - Microbiology 2022Quote: A second-round PCR amplification with allele-specific primers was carried out using DreamTaq DNA Polymerase (Thermo Scientific, EP0702) PCR in a final volume of 20 μl as follows ...
-
bioRxiv - Physiology 2022Quote: ... The attB PCR primer were designed according to manufacturer’s protocol (Gateway cloning system, Thermo Fisher Scientific, Waltham MA, USA). Forward primer contains Shine-Dalgarno and Kozak consensus sequence for protein expression in both E.coli and mammalian cells ...
-
bioRxiv - Molecular Biology 2022Quote: ... p2×7 (Mm00440582_m1) and tgfβ (Mm01178820_m1) were determined by quantitative PCR using Taqman primers and probe (Applied Biosystems, USA) and Taqman Gene Expression Master Mix (Applied Biosystems ...
-
bioRxiv - Molecular Biology 2022Quote: ... Reverse transcription PCR was performed with the RevertAID First Strand cDNA synthesis kit and Oligo-dT primers (Thermo Scientific). DCAF15 RNA was quantified in a PCR reaction using SYBR select master mix (Fisher Scientific ...
-
bioRxiv - Neuroscience 2022Quote: Entry plasmids containing specific coding DNA sequences were constructed by PCR from N2 cDNA with primers flanked with attB1 and attB2 recombination sites and cloned into pDONR_221 vector (Invitrogen) by BP recombination ...
-
bioRxiv - Molecular Biology 2022Quote: ... using gene-specific PCR primers (Supplemental Table S1) mixed with Power SYBR Green Master Mix (Thermo Fisher Scientific, 4367659) and diluted cDNA (10-fold dilution ...
-
bioRxiv - Physiology 2023Quote: ... TaqMan® Fast Universal PCR Master Mix and TaqMan assays (primers/probes) purchased from Life Technologies (Grand Island, NY). Reactions were run in duplicate on the QuantStudio-3 real-time PCR system (Applied Biosystems ...
-
bioRxiv - Cell Biology 2023Quote: ... qPCR was performed using TaqMan Fast Universal PCR mix and target (UTY) primer conjugated to FAM-probe (Hs01076483, ThermoFisher) with 18s rRNA primer (4319413E conjugated to VIC probe ...
-
bioRxiv - Synthetic Biology 2023Quote: ... the PRhaBAD promoter and CRISPR array with oriT spacer were amplified from pCas3cRh-oriT with tailed primers oriT_Cas3_F/R and the pSEVA521 backbone was linearized with Phusion PCR (Thermo Scientific) with tailed primers oriTcas3_SEVA_F/R (Table S1) ...
-
bioRxiv - Neuroscience 2023Quote: ... aliquots of single-stranded cDNA were amplified with gene-specific primers and Power SYBR Green PCR Master Mix (Invitrogen) using the CFX96™ real time PCR detection system (Bio-Rad) ...
-
bioRxiv - Cell Biology 2023Quote: ... quantitative PCR (qPCR) was performed using a gene-specific primer utilizing Powerup SYBR green master mix (Applied Biosystems # A25742). Fold change (2-ΔΔCt ...
-
bioRxiv - Cell Biology 2023Quote: ... genome and SeV-carried pluripotency genes in iPSCs occurred through PCR using cDNA from each iPSC line and primers provided by the CytoTune-iPS 2.0 Sendai Reprogramming Kit (Invitrogen). PCR was also performed on cDNA from each iPSC line in order to detect expression of pluripotency markers SOX2 ...
-
bioRxiv - Molecular Biology 2024Quote: ... 0.25 µM of specific primers and 10 µl of Fast SYBR™ Green PCR Master Mix (Applied Biosystems; #4385612) in a total volume of 20 µl ...
-
bioRxiv - Microbiology 2024Quote: ... Standards for viral copy number were created by cloning PCR product using custom BdDV-1 primers into the pCR 2.1-TOPO vector using the TOPO TA cloning kit (Invitrogen). Transformed Escherichia coli colonies with successful insert were plasmid extracted using the Zyppy Plasmid Miniprep kit (Zymo Research) ...
-
bioRxiv - Bioengineering 2024Quote: ... and forward/reverse primers from IDT Technology in the QuantStudio™ 5 Real-Time PCR System (Applied Biosystems; A28574). The cycle was run 40 times at 95°C denaturation for 30 sec ...
-
bioRxiv - Cancer Biology 2024Quote: DNA was PCR-amplified and barcoded with P5/P7 primers (Integrated DNA Technologies) using Taq-Gold DNA polymerase (Thermofisher) according to the manufacturer’s instructions ...
-
bioRxiv - Bioengineering 2024Quote: ... and forward/reverse primers from IDT Technology in the QuantStudio™ 5 Real-Time PCR System (Applied Biosystems; A28574). The cycle was run 40 times at 95°C denaturation for 30 sec ...
-
bioRxiv - Cell Biology 2023Quote: ... PCR with primers p4 (5’ ATTTCAGTGG GACCTCAATGCC) and p5 (5’ GTGA CAGTCCAGGTGGAAACAAA) and Bpu10I digestion (Thermo Fisher Scientific #FD1184) was used to confirm the genomic differences between the KO + hTRIM28 and the KO + hTRIM28(S473A ...
-
bioRxiv - Microbiology 2024Quote: ... and Reverse primer: 3’-GGGCGGTAGTCGTAATTGTT-5’ were subjected to qRT-PCR for amplifying Amastin in QuantStudio 5 (Applied Biosystems) in triplicates ...
-
bioRxiv - Molecular Biology 2021Quote: ... with differently labeled probe sets (Life Technologies) allowing to use renilla counts as an internal control ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... NED and HEX sets (Applied Biosystems, Tokyo). As for PCR ...
-
bioRxiv - Immunology 2020Quote: ... IL-13 (Ready-SET-go, ThermoFisher Scientific) and IL-33 (Duoset ...
-
bioRxiv - Immunology 2021Quote: ... Cell Sorting Set-up Beads (Life Technologies) were used to quantify and normalized cell number between samples and experiments ...
-
bioRxiv - Cell Biology 2021Quote: ... Pre-designed probe sets (Thermo Fisher Scientific) were used as follows ...
-
bioRxiv - Immunology 2022Quote: ... or the Fix/Perm buffer set (Invitrogen) according to the manufacturer’s protocol ...
-
bioRxiv - Developmental Biology 2022Quote: ... we set-up TaqMan assays (ThermoFisher Scientific) in 96-well plates ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... and treat with PureLink DNase set (Invitrogen). RNA samples were quantified by measuring absorbance at 260nm with the Qubit RNA HS assay kit ...
-
bioRxiv - Cancer Biology 2023Quote: ... with DNase set (12185010, Thermo Fisher Scientific). The Agilent Bioanalyzer confirmed that the RIN counts of the RNA samples were greater than >8.5 ...
-
bioRxiv - Microbiology 2023Quote: TMTpro 16plex Label Reagent Set (Fisher Scientific) was used for isobaric labeling as directed by the manufacturer26 ...
-
bioRxiv - Molecular Biology 2023Quote: ... 5 mM NTP Set (Thermo Fisher, R0481), 0.2 units yeast inorganic pyrophosphatase (NEB) ...
-
bioRxiv - Molecular Biology 2024Quote: ... The default probe sets defined by Affymetrix were used to assess array quality using the Area Under the [Receiver Operating Characteristics] Curve (AUC ...
-
bioRxiv - Developmental Biology 2021Quote: Total RNA was reverse-transcribed into cDNA using a SuperScript III First-Strand Synthesis System for RT-PCR (Invitrogen). PCR was conducted with primer sets (Table S1 ...
-
bioRxiv - Developmental Biology 2021Quote: ... Total RNA was reverse-transcribed into cDNA using a SuperScript III First-Strand Synthesis System for RT-PCR (Invitrogen). The amplification conditions for PCR were 2 min at 50°C ...
-
bioRxiv - Molecular Biology 2020Quote: ... Quantitative RT-PCR analysis was performed using the Power SYBR Green RNA-to-Ct 1-Step kit (Applied Biosystems) according to the manufacturer’s instructions ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... We performed quantitative RT-PCR on an Applied Biosystems StepOnePlus machine using Fast SYBR Green Master Mix (Applied Biosystems). We used a 10 μL reaction containing 1.5 μL of 1:1 diluted cDNA ...