Labshake search
Citations for Thermo Fisher :
151 - 200 of 10000+ citations for Fish Sperm DNA since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... were transfected with a fixed final amount of pre-mixed biosensor-encoding DNA (0.57 μg, adjusted with salmon sperm DNA; Invitrogen) and human receptor DNA ...
-
bioRxiv - Genomics 2019Quote: ... and salmon sperm (Invitrogen, 15632011), and precipitated with 1/10th volume of 3M sodium acetate ...
-
bioRxiv - Neuroscience 2020Quote: ... 10mg/ml Salmon Sperm (Invitrogen) and 50µg/ml Heparin ...
-
bioRxiv - Genomics 2022Quote: ... 1 μg salmon sperm (ThermoFisher) and 10 fmol of each 5C oligonucleotide in 1X NEBuffer™ 4 (5C set of oligonucleotides described in Nora et al. ...
-
bioRxiv - Genetics 2021Quote: ... COT-1 FISH was carried out using labeled mouse COT-1 DNA (Invitrogen). For quantification ...
-
bioRxiv - Genomics 2019Quote: ... Genomic DNAs from individual fish were then quantified using a Qubit fluorometer (Thermofisher) and pooled in equimolar ratios by individual and sex ...
-
bioRxiv - Molecular Biology 2022Quote: ... DNA FISH probes were prepared following the manufacturer’s recommendations (ThermoFisher # F32947 and F32949) using the BAC construct (BACPAC Resources #CH322-184J4 ...
-
bioRxiv - Developmental Biology 2023Quote: Branched DNA FISH was performed using the viewRNA Cell Plus assay from ThermoFisher Scientific (88-19000-99 ...
-
bioRxiv - Molecular Biology 2022Quote: ... 10ul of each probe was precipitated with 1 μl of salmon sperm DNA (ThermoFisher Scientific), 30.3 μl of 100% ethanol and 1.1 μl of 3M sodium acetate ...
-
bioRxiv - Immunology 2022Quote: ... Anti-dsDNA antibodies were quantified by coating 100 µg/mL of salmon sperm DNA (Invitrogen) in a 96-well flat-bottom plate (Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2023Quote: ... 1 M lithium acetate and 10 mg/mL denatured herring sperm DNA (Thermo Fisher Scientific) was added and incubated overnight shaking at 30 °C ...
-
bioRxiv - Molecular Biology 2020Quote: Purified motile sperm were fluorescently labeled using Live/Dead Sperm Viability Kit (Invitrogen, Thermofisher Scientific). SYBR 14 dye ...
-
bioRxiv - Molecular Biology 2020Quote: Purified motile sperm were fluorescently labeled using Live/Dead Sperm Viability Kit (Invitrogen, Thermofisher Scientific). SYBR 14 dye ...
-
bioRxiv - Molecular Biology 2020Quote: Purified motile sperm were fluorescently labeled using Live/Dead Sperm Viability Kit (Invitrogen Molecular Probes), which stains live sperm with SYBR 14 dye ...
-
bioRxiv - Bioengineering 2021Quote: Purified motile sperm were fluorescently labeled using Live/Dead Sperm Viability Kit (Invitrogen Molecular Probes), which stains live sperm with SYBR 14 dye ...
-
bioRxiv - Molecular Biology 2020Quote: Purified motile sperm were fluorescently labeled using Live/Dead Sperm Viability Kit (Invitrogen Molecular Probes), which stains live sperm with SYBR 14 dye ...
-
bioRxiv - Bioengineering 2021Quote: Purified motile sperm were fluorescently labeled using Live/Dead Sperm Viability Kit (Invitrogen Molecular Probes), which stains live sperm with SYBR 14 dye ...
-
bioRxiv - Cell Biology 2019Quote: ... For iPALM experiments 1µg of DNA and 2µl of sheared salmon sperm DNA were mixed together in 15µl of Opti-MEM (Thermofisher scientific, 31985062), and kept on ice for 15 min ...
-
bioRxiv - Cell Biology 2021Quote: To prepare the probe for hybridisation approximately 200-600ng of labelled probe DNA was ethanol precipitated with the 5 µg of sheared salmon sperm DNA and 5 µg of mouse or human Cot1 DNA (both from Invitrogen) and resuspended in hybridisation buffer (50% formamide ...
-
bioRxiv - Synthetic Biology 2024Quote: ... 100 μL of this mixture was added to 64 μL DNA cocktail containing 10 μL of boiled salmon sperm DNA (ThermoFisher) per transformation ...
-
bioRxiv - Biochemistry 2020Quote: ... followed by incubation in blocking buffer I supplemented with 200 μg/ml salmon sperm DNA (Invitrogen) for an additional 45 min ...
-
bioRxiv - Biophysics 2023Quote: ... 0.05% Tween-20 (w/v) and 0.3 mg/mL Ultrapure Salmon Sperm DNA (ThermoFisher Scientific 15632011).
-
bioRxiv - Biochemistry 2023Quote: ... 0.05% Tween-20 (w/v) and 0.3 mg/mL Ultrapure Salmon Sperm DNA (ThermoFisher Scientific 15632011). His-Tag Dynabeads (Invitrogen 10103D ...
-
bioRxiv - Immunology 2023Quote: ... 2 µM mouse cGAS was incubated with 0.1 µg/µL salmon sperm DNA (Invitrogen, 15632-011) or no DNA for 1 h at 37 °C as the positive and negative control ...
-
bioRxiv - Cell Biology 2024Quote: ... The blocking buffer was supplemented with 0.1 mg/mL sheared salmon sperm DNA (Thermo Fisher 15632011) and 0.05% w/v dextran sulfate (Merck D4911 ...
-
bioRxiv - Molecular Biology 2023Quote: ... previously preincubated overnight with 5% BSA and 667 µg/ml Ultra-Pure salmon sperm DNA (Invitrogen), and incubated for 3 h at 4 °C ...
-
bioRxiv - Microbiology 2020Quote: FISH with 16S DNA probes was conducted on the surface of UltraStick Slides (Thermo Scientific). Aliquots of plaque were dried on the slides for 10 min at 46°C ...
-
bioRxiv - Biophysics 2022Quote: ... The tether was then moved to Channel 3 containing 0.5 mg/mL salmon sperm DNA (Thermo Fisher) in HR buffer except for MCM/ORC salt stability assays ...
-
bioRxiv - Molecular Biology 2020Quote: ... Blocking was achieved by incubating the beads with 1mg.mL-1 of Ultrapure BSA and 0.5mg.mL-1 of salmon sperm DNA (Invitrogen) overnight at 4°C ...
-
bioRxiv - Neuroscience 2020Quote: ... The acetylated sections were washed and incubated in hybridization buffer (50% formamide, 0.25 mg/mL yeast RNA, 0.5 mg/mL herring sperm DNA, 5x Denhard’s, 5x SSC, Invitrogen) at room temperature for 1 hr ...
-
bioRxiv - Biochemistry 2022Quote: ... The oil phase was washed three times with 100 µl 2 ng/µl salmon sperm DNA (Invitrogen). The aqueous phase was purified and transformed into E ...
-
bioRxiv - Cell Biology 2020Quote: ... the DNA coupled beads were resuspended in PBB buffer and Salmon sperm (10 mg/ml, Ambion, #AM9680) was added 1:1000 as competitor for unspecific DNA binding ...
-
bioRxiv - Genomics 2019Quote: ... Up to 200ng total probe per cover slip was combined with 10ug salmon sperm DNA (ThermoFisher 15632011), 4ug human Cot1 DNA (ThermoFisher 15279011) ...
-
bioRxiv - Cancer Biology 2023Quote: ... The sheared salmon sperm DNA was used directly from its original 10 mg/ml stock (ThermoFisher, AM9680). To create a humidity chamber ...
-
bioRxiv - Biophysics 2023Quote: ... 100 ng/well pSems-mEGFP-TMD plasmid and 2.25 μg/well sheared salmon sperm DNA (#AM9680, Invitrogen) or 500 ng/well of the pN1-GPI-mEos3.2 ...
-
bioRxiv - Biophysics 2023Quote: ... plasmid and 1.5 μg/well sheared salmon sperm DNA were transfected using Lipofectamin 3000 (Thermo Fisher Scientific) following the manufacturer’s protocol in 6-well plates ...
-
bioRxiv - Molecular Biology 2023Quote: ... Cells were resuspended in 140 μL 0.1M LiOAc and 32 μL salmon sperm DNA (10mg/mL Invitrogen). Purified PCR product (250-500 ng ...
-
bioRxiv - Cell Biology 2023Quote: ... The total amount of DNA in each transfection was normalized to 5 μg with UltraPure Salmon Sperm DNA solution (Thermo Fisher Scientific). 48 hours following transfection ...
-
bioRxiv - Immunology 2021Quote: ... and subsequently with salmon sperm dsDNA (Invitrogen) or SmRNP (Arotec Diagnostics) ...
-
bioRxiv - Bioengineering 2022Quote: ... or fluorescent oligonucleotide probes/constructs (10-50 nM in PBS with 0.025% T20, 300 mM NaCl, 0.5 mg/mL sheared salmon sperm DNA [SSS DNA, ThermoFisher] and 0.5% dextran sulfate [Sigma]) for 30 min at room temperature ...
-
bioRxiv - Bioengineering 2020Quote: ... sender cells were initially resuspended and incubated with 100 µg/mL salmon sperm DNA (Thermo Fisher Scientific 15632011). Sender cells were then incubated with 3.5 µM HaloTag-conjugated oligonucleotides (5AmMC12/TCTAGGCGCCCGGAATTAGAT/3Bio ...
-
bioRxiv - Cancer Biology 2022Quote: ... in 250 μ nuclear stain (1:600) and 0.5 mg/ml sheared salmon sperm DNA (Thermo Fisher, #AM9680). DRAQ5 nuclear stain (Cell Signaling Technologies ...
-
bioRxiv - Biochemistry 2020Quote: ... 2 g/L Bovine Serum Albumin (BSA, Fischer Scientific) and 200 mg/L Salmon Sperm DNA solution (Invitrogen).
-
bioRxiv - Molecular Biology 2021Quote: ... followed by the incubation with protein A/G magnetic beads that were pre-blocked with 0.5 mg/mL BSA and 0.125 mg/mL herring sperm DNA (Invitrogen). The beads were subsequently washed with low-salt buffer ...
-
bioRxiv - Plant Biology 2019Quote: ... Beads were pre-treated with 0.1% (w/v) non-fat milk in 1X PBS and 0.5 mg/mL sheared salmon sperm DNA (Invitrogen). Following de-crosslinking ...
-
bioRxiv - Plant Biology 2022Quote: ... Sheared chromatin was pre-cleared by salmon sperm (SS) DNA/Protein A/G agarose beads (Thermo Fisher Scientific) before overnight incubation with anti-GFP antibody (ABclonal ...
-
bioRxiv - Cell Biology 2022Quote: ... blocked in PBB buffer supplemented with 10 µg mL−1 BSA and sheared salmon sperm DNA (Thermo Scientific) and finally taken up in PBB buffer ...
-
bioRxiv - Neuroscience 2023Quote: ... The extracts were then diluted in 5% Tween 20 with UltraPure™ Salmon Sperm DNA Solution (ThermoFisher, 15632011). The amount of AAV that passed through the transwell was measured by qPCR using a standard curve of known AAV quantities derived from AAV-containing media applied to the top well.
-
bioRxiv - Evolutionary Biology 2021Quote: ... to the tube was added a solution of 0.269 mg of P58 mixed 5:1 by volume with salmon sperm DNA (Invitrogen), followed by 3 mL of 39.52% polyethylene glycol ...
-
bioRxiv - Molecular Biology 2022Quote: ... Cells in each well were transiently transfected using 100 ng V2R and 900 ng sheared salmon sperm DNA (Invitrogen) and 1:3 25 kDa linear Polyethylenimine (Polysciences ...